I've run Bismark to align a set of BS-Seq data. Some (not all) of the samples had low mapping efficiency (~20%). I then tried mapping R1 and R2 separately and found that R1 mapped at >70% while R2 mapped at ~30% (both in undirectional mode). Then I tried bsseeker and it reported a 72.2% mapping rate. By checking the CIGAR, I saw that most of the R2 reads contained a not short soft clipping in the ends (e.g. 91M60S). An examples of these reads is:
A00437:548:HN5NMDSX3:1:1101:24939:1344 (aligned by bsseeker but not bismark. CIGAR: 60M91S; POS: chr1:159204290)
AAGTTTTTTATATATAGATATGTGTATAATGATATATAGTAAATGTATATAGAGTTTAGTGTGAGAGTGGGAGGGTTGGGGTGGTTGTTGAGGTTGTATAATGAAGTTATTTTAGGGAGTTATTGGGTGTTTGTTTAGTTATTTATGGGTT
The bolded part was soft-clipped, while the front part mapped to chr1:159204290-159204349 (60nt) if converting all Cs to Ts in the reference.
I checked the fastqc of these reads but didn't see adaptor contamination or over-represented sequences in R2, so it's a mystery what these clipped sequences are and why they occur only in R2. Does anyone have any ideas? Thanks.
-
The first FDA-approved CRISPR-based therapy marked the transition of therapeutic gene editing from a dream to reality1. CRISPR technologies have streamlined gene editing, and CRISPR screens have become an important approach for identifying genes involved in disease processes2. This technique introduces targeted mutations across numerous genes, enabling large-scale identification of gene functions, interactions, and pathways3. Identifying the full range...08-27-2024, 04:44 AM