Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • attila.szanto
    replied
    Thanks. The confusion came from the difference between the two illumina primers I mentioned (PE PCR Primer 2.0 and Multiplexing PCR Primer 2.0). The first one is for regular paired end seq and the other is for multiplexing. So, I had to design my oligos, so that I could do paired end seq and also include a barcode to filter out pcr artifacts. And I followed the logic of the standard illumina multiplexing oligos. However, instead of using 3 primers in the pcr, I add the barcode to the adapters. And just want to double check if the library ready for seq has the right sequences to bind to the flow cell and also to seq with Multiplexing Read 1, Read 2 and Index Read primers. I could find such a sequence only for PE but not for multiplexing.
    Anyway, thanks for your help.

    Leave a comment:


  • cascoamarillo
    replied
    It's easy to check if you do a little of research. What I see is a standard Illumina RNA-seq library ready for multiplexing; with the read primer 1 (Rd1 SP) region, the index SP primer and the read primer 2 (Rd2 SP).

    I'm not sure about the other primers you mention, couldn't find any match with what I have. Are they for DNA, RNA-seq, smallRNA...?

    Leave a comment:


  • attila.szanto
    started a topic Multiplexing

    Multiplexing

    Can anyone please check the following seq if it could work for a multiplexing PCR product?

    AATGATACGGCGACCACCGAGATCT ACACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNNN AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC NNNNNN ATCTCGTATGCCGTCTTCTGCTTG
    TTACTATGCCGCTGGTGGCTCTAGA TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA NNNNNN TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG NNNNNN TAGAGCATACGGCAGAAGACGAAC


    Also, I would appreciate if someone could tell me why there is a difference between PE PCR Primer 2.0 and Multiplexing PCR Primer 2.0. I mean between the middle part:

    CAAGCAGAAGACGGCATACGAGAT CGGTCTCGGCATTCCTGCTGAACC GCTCTTCCGATCT and the
    ----------------------------GTGACTGGAGTTCAGACGTGT GCTCTTCCGATCT

Latest Articles

Collapse

  • seqadmin
    Multiomics Techniques Advancing Disease Research
    by seqadmin


    New and advanced multiomics tools and technologies have opened new avenues of research and markedly enhanced various disciplines such as disease research and precision medicine1. The practice of merging diverse data from various ‘omes increasingly provides a more holistic understanding of biological systems. As Maddison Masaeli, Co-Founder and CEO at Deepcell, aptly noted, “You can't explain biology in its complex form with one modality.”

    A major leap in the field has
    ...
    02-08-2024, 06:33 AM
  • seqadmin
    The 3D Genome: New Technologies and Emerging Insights
    by seqadmin


    The study of three-dimensional (3D) genomics explores the spatial structure of genomes and their role in processes like gene expression and DNA replication. By employing innovative technologies, researchers can study these arrangements to discover their role in various biological processes. Scientists continue to find new ways in which the organization of DNA is involved in processes like development1 and disease2.

    Basic Organization and Structure
    Understanding...
    01-22-2024, 03:25 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 08:52 AM
0 responses
10 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 08:57 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-14-2024, 09:19 AM
0 responses
48 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-12-2024, 03:37 PM
0 responses
422 views
0 likes
Last Post seqadmin  
Working...
X