I'm new to small RNA sequencing, and a bit confused about some of the sequences I'm seeing and wonder if you can provide some tips. I'm looking at a public dataset (SRP032955) in which the reads have already been de-multiplexed (if they were barcoded in the first place) to single-sample files. After I trim off the Illumina 3' adapter, I still have a number of sequences that are very highly repeated, but which I can't identify as sequencing artifacts. Here's a good example:
>raw read (3' adapter in red)
TCTATGTTCAGTGCGACTGCATGGAATTCTCGGGTGCCAAGGAACTCCAG
>resulting trimmed read
TCTATGTTCAGTGCGACTGCA
This trimmed read appears 23584 times, or 1.3% of the reads. FastQC labels it as "No Hit" in the Overrepresented sequences list, along with a whole bunch of other "No Hit" highly-repeated sequences.
Is this a real *RNA or an artifact? It doesn't BLAST to the Maize B73 genome, although this sample is Maize W23, for which I don't have a genome sequence handy.
-
Spatial biology is an exciting field that encompasses a wide range of techniques and technologies aimed at mapping the organization and interactions of various biomolecules in their native environments. As this area of research progresses, new tools and methodologies are being introduced, accompanied by efforts to establish benchmarking standards and drive technological innovation.
3D Genomics
While spatial biology often involves studying proteins and RNAs in their...01-01-2025, 07:30 PM