Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • AdamB
    replied
    Thanks for your reply. I wasn't sure whether Cufflinks would continue in the wrong way or give an error message, had it been wrong.

    Leave a comment:


  • GKM
    replied
    If cufflinks runs then you shouldn't have any problems arising from the sorting. It sorted the chromosomes as strings, not as numbers, but as long as the positions are sorted numerically, it should be fine, and they are (it would have given you an error otherwise)

    Leave a comment:


  • AdamB
    started a topic Cufflinks SAM file sort problem

    Cufflinks SAM file sort problem

    The Cufflinks manual states that SAM files should be sorted according to the following:
    Code:
    sort -k 3,3 -k 4,4n hits.sam > hits.sam.sorted
    However, when I sort this way, the chromosomes are sorted something like this:
    Code:
    chr1
    chr11
    [...]
    chr19
    chr2
    chr20
    chr3
    [...]
    chr9
    I assume the intention of the sort is to end up with chr1 ... chr20, chrX, in numerical order? If so, how can I achieve this? I tried using various flags for field 3, and I also tried making "chr" a delimiter, but it seems delimiters must be one character long.

    I've been running Cufflinks with my SAM files ordered like this, but I've no idea if it will make a difference or not.

    Note: I started with Bioscope BAM files (PE, strand-specific), which were converted to SAM with SAMtools. The 'XS:A:' field was added based on strand info from field 2. A sample of my SAM files is below:
    Code:
    1384_723_1125   0       chr1    121     0       25M     *       0       0       CATTTTCCTCTAGAGTCAGAAACGN       IH8IIIIIIIIIEII77IIIIHEI!
           NH:i:0  RG:Z:20100828211420290  CS:Z:G3130002022232221112200133 CQ:Z:BB'2BBB?2BB?42BB776BA:/75  SM:i:0  CM:i:2  XS:A:+  
    200_1536_1533   73      chr1    7467    1       18H28M4H        *       0       0       GTTTTTCCTAATTTGATATTTAAAAAAA    //-.2.**787;033""".*)--4F>.,    NH:i:0  RG:Z:20100828211420290  CS:Z:T12132211201311202001000020230300122130030000002000        CQ:Z:6??<=?><;A;AA?/-%,)')%*)&%&2'1+&.&%))&%%)%07('&2-* SM:i:2  CM:i:2  XS:A:+  
    2234_1292_1060  129     chr1    8334    33      25M     chr8    47073575        0       GAGATCCCCAAGAATCCTTACCTTT       +EIII))))519IIIA5:8/%:D4&       NH:i:1  RG:Z:20100828211420290  CS:Z:G0222320001022032020320200 CQ:Z:'%ABB<)=>)-%5=B=%1*/<%6/&  SM:i:1  CM:i:3  XS:A:+  
    21_385_199      89      chr1    10073   0       3H27M20H        *       0       0       AGCCCCGAAAAAAAAAATAAATATCAG     72/@I91=B?@4/03E@<II%%,/(0I     NH:i:0  RG:Z:20100828211420290  CS:Z:T01223203301132231023222233100330000000002300032030        CQ:Z:&,87'*/%%%.*-((/%&+*5:0((%%684)8.&+%01/4*(28)',,)6 SM:i:3  CM:i:2  XS:A:-
    Can anyone clarify this issue for me? Thanks.

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
30 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 09:45 AM
0 responses
202 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 08:54 AM
0 responses
212 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-02-2024, 03:00 PM
0 responses
194 views
0 likes
Last Post seqadmin  
Working...
X