Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Help needed to prepare consensus including overhangs (non overlapping reads)!

    Hi, I am new to programming and bioinformatics. I am having trouble merging my pre-trimmed fastq files to merge with the inclusion of the overhangs/nonoverlapping reads at either end. I tried PEAR before, which gave me final consensus only for the overlapping region. I tried bbmerge and it gave me the same thing. And I am not able to figure out what script I should use to have the final consensus that includes overhangs added to ends of my consensus so I have the full consensus sequences. For example, I have following fastq reads. Could any expert help me with a custom script for this? thanks.

    @S1_A01_015_F
    ATTTATTTTTGGTGCTTTTTCTGGTGTAGTAGGAACTACATTATCTGTTTTAATTAGAATGGAATTAGCACAACCCGGTAATCAAATTTTTGCTGGGAATCATCATTTATATAATGTTGTTGTTACAGCACATGCATTTATTATGATTTTTTTTATGGTTATGCCTGTTTTAATAGGTGGTTTTGGTAATTGGTTTGTACCTTTAATGATTGGTGCTCCAGATATGGCTTTTCCTCGTATGAATAATATAAGTTTTTGGTTATTACCACCATCATTATTATTATTAGTTTCTTCAGCTATTGTTGAATCAGGTGCAGGTACTGGTTGGACTGTATATCCTCCTTTATCAAGTGTACAAGCACATTCAGGTCCTTCAGTAGATTTAGCTATTTTTAGTTTACATTTATCAGGTATTTCTTCTTTATTAGGTGCTATTAATTTTTTATCTACTATTTATAATATGAGAGCTCCAGGTTTAAGTTTTCATAGATTACCTTTATTTGTTTGGGCTATATTTATTACTGCTTTTTTATTATTATTAACTTTACCTGTATTAGCTGGTGCAATTACTATGTTATTAACTGATAGAAACTTAAATACATCTTTTTACGATCCATCAGGCGGAGGAGATCCTGTATTATACCAACATTTATTTTGGTTTTTCGGCAACCCCGGAAG
    +
    9>*%**ROOAB*,78K[[[[W>W:0G6J@RP_J__Y_TPK_W_MRP\\__\\__\\\_W;W___\_\W___\__________\___W____\\_W____\___\_________WK__RW____\__\__________RKWWW__RW__W_WRW________________WWWW_\YW___WWWW______WW_WWW_____W_________________\S______LRRW_____Y____________\_W_________________________________\__________________W________________________________WRRWWW___________________________________________________\_____________________________________________RRR_____________________O_____________________________________________________[[[[R[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[[WW[[[[[[[[[[[[[[[[[[[[[R[[[[[[W[T[[[[[[[[[[[[R[[[[[[W[[R[[[MQ[[SO[W[LJB[[HMLWRT[[UPRSSSSJ=ISLM[ISIHKSS>@[IDD''&&&&*<A5-*((5
    ​
    @S1_A01_015_R
    CTCCTCGCCTGATGGATCGTAAAAGATGTATTTAAGTTTCTATCAGTTAATAACATAGTAATTGCACCAGCTAATACAGGTAAAGTTAATAATAATAAAAAAGCAGTAATAAATATAGCCCAAACAAATAAAGGTAATCTATGAAAACTTAAACCTGGAGCTCTCATATTATAAATAGTAGATAAAAAATTAATAGCACCTAATAAAGAAGAAATACCTGATAAATGTAAACTAAAAATAGCTAAATCTACTGAAGGACCTGAATGTGCTTGTACACTTGATAAAGGAGGATATACAGTCCAACCAGTACCTGCACCTGATTCAACAATAGCTGAAGAAACTAATAATAATAATGATGGTGGTAATAACCAAAAACTTATATTATTCATACGAGGAAAAGCCATATCTGGAGCACCAATCATTAAAGGTACAAACCAATTACCAAAACCACCTATTAAAACAGGCATAACCATAAAAAAAATCATAATAAATGCATGTGCTGTAACAACAACATTATATAAATGATGATTCCCAGCAAAAATTTGATTACCGGGTTGTGCTAATTCCATTCTAATTAAAACAGATAATGTAGTTCCTACTACACCAGAAAAAGCACCAAAAATTAAATATAAAGTACCTATGTCTTTATGATTTGTTGAAAA
    +
    B*+'2+(0C2W:0[C4'L4(*'*)/=1:?HJ[J<=7____HH_GJI_FS_Y__PP_R___TN_\\T_\M\_\_\\_\OY__\_\_______RR__\_________\__W______\OSYYW_Y___\\\\YCLW_____W_\WW\______\\\\Y_YWYWW___Y\_______W_\SAG<KQY_WRW_____YWQWY\_O\\EYYQN_WC_\Y___\Y_\\__\___\\\_\_\_____Y__\_\__\__YWW_Y_\__\_WQY_Y_Y___\\_\_Y__KYYWLLW_SWWO\___OY\_\Y____\_______\____\__________YYLLWQE_\\___R_____\\\YMYYOOY___________YYYYY\\OOY\\\________N_SRFG__Y\\YYY_YORR_Y__Y__YR___YYYOY__________Y____LYY_OO_Y_____L_Y___YY_________O______________YYLJOYH?=OL___________MU_U___________[NUNMOUURWOQUUUPIIW[OMWOU7?OUUUPWU[[[UUN[WNLW[[WWUWNMU[[U[U[UDLC[QSHRWRSPWQMPQS[VTS[JJPPS[TTTT[[[PQR[[[[[RRJHMRTQQRR[W[R[[LQQSW@MLA9J1QQKL
    ​

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-13-2024, 08:58 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
186 views
0 likes
Last Post seqadmin  
Working...
X