Hello everybody,
I have little experience with library preparation and Illumina sequencing
. I just want to know if it makes sense what I am planning to do.
I have to generate multiplex libraries to perform mRNA-Seq with Illumina.
I have to create a library similar to the PARE as I am interested in mRNA processing products (but I am not going to use the mmeI and oligo dT cDNA synthesis). The degraded mRNA will be ligated to a 5' RNA adapter, followed by fragmentation, cDNA synthesis with random primer holding a tag, PCR amplified and sequenced. What is the range in the length of RNA fragmented products? PCR products have to be purified prior to sequencing?
I wonder if I can use the Illumina 5' adaptor 5' GUUCAGAGUUCUACAGUCCGACGAUC (like in TruSeq small RNA library prep) and a random primer holding as tag the Illumina 3' adaptor sequence 5'TGGAATTCTCGGGTGCCAAGG and PCR with Illumina RNA PCR Primers index 1-48. When sending for sequencing which service do I have to use then? small RNA seq with HiSeq2000 even though I am not sequencing small RNAs?
Can I purchase only these adapters and primers from Illumina ? I just know that I can buy the multiplex primers, but what about adapters?
Thank you very much

S.
I have little experience with library preparation and Illumina sequencing

I have to generate multiplex libraries to perform mRNA-Seq with Illumina.
I have to create a library similar to the PARE as I am interested in mRNA processing products (but I am not going to use the mmeI and oligo dT cDNA synthesis). The degraded mRNA will be ligated to a 5' RNA adapter, followed by fragmentation, cDNA synthesis with random primer holding a tag, PCR amplified and sequenced. What is the range in the length of RNA fragmented products? PCR products have to be purified prior to sequencing?
I wonder if I can use the Illumina 5' adaptor 5' GUUCAGAGUUCUACAGUCCGACGAUC (like in TruSeq small RNA library prep) and a random primer holding as tag the Illumina 3' adaptor sequence 5'TGGAATTCTCGGGTGCCAAGG and PCR with Illumina RNA PCR Primers index 1-48. When sending for sequencing which service do I have to use then? small RNA seq with HiSeq2000 even though I am not sequencing small RNAs?
Can I purchase only these adapters and primers from Illumina ? I just know that I can buy the multiplex primers, but what about adapters?
Thank you very much


S.
Comment