Announcement

Collapse

Welcome to the New Seqanswers!

Welcome to the new Seqanswers! We'd love your feedback, please post any you have to this topic: New Seqanswers Feedback.
See more
See less

Why does mpileup skip my mutation ?

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Why does mpileup skip my mutation ?

    (cross posted on biostar: http://biostar.stackexchange.com/questions/9961 )

    Hi all,

    I know, by capillary sequencing, that one of my samples contains a mutation at position:120458492.

    Some reads were aligned with bwa and I can clearly see my mutation using samtools tview.

    Code:
           120458491 120458501
    CCTGCTCTGGGGAGCTATGCCAGGATGGGTGCC
    ........R........................
    .....C..A..................C.....
    ........C. ......................
    ............  ...................
    ........A.....    ...............
    ,,,,,,,,a,,,,,,,,,,,,,,,,  ......
    ,,,,,,,,a,,,,,,,,,,,,,,,,,,,    .
    ........A........................
    ........A........................
    .............................C...
    ........A........................
    .................................
    ........A........................
    .................................
    .................................
    ........A........................
    ......................C..........
    ........A........................
    ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,
    ........A........................
    .................................
     ................................
      ...............................
       .....A........................
          ,,,,,,,,,gg,,,,,,,,,,,t,,,,
           .A........................
            .........................
    however, we I call the mutations using samtools mpileup

    Code:
    ${SAMTOOLS}/samtools mpileup -uf  ${HG19} sample.bam |\
      ${SAMTOOLS}/bcftools/bcftools view  -bvcg - > snps.bcf
    ${SAMTOOLS}/bcftools/bcftools view  snps.bcf | gzip --best > snps.vcf.gz
    But I can't see the mutation in the VCF.

    here is the output of pileup (not mpileup):

    Code:
    (...)
    chr1    120458492   G   26  C.AaaAA.A.A..A.A,A...A,AA^].    JddfhQacfhhgggahehhhhaB[hg
    (...)
    How can I know why mpileup (or bcftools ?) skipped this mutation ?

    Thanks !

    Pierre

  • #2
    Try redoing mpileup with -Buf. That's worked for me. Like you, I observed that my sanger-verified mutation looked fine in pileup, but when I looked at it in the mpileup run without -B, the Baq calculations destroyed the quality scores of that locus, so it wouldn't call a SNP. Running it with -B should make your mpileup look like your pileup at that locus, and then the SNP will have high enough quality to be counted.

    Comment


    • #3
      That worked ! many thanks !

      Comment


      • #4
        try -E
        ...

        Comment

        Working...
        X