Announcement

Collapse
No announcement yet.

Phred score of i

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • kmcarr
    replied
    The latest versions of the Illumina software will assign base qulities up to 41, which would be represented as an 'i' if the FASTQ file is encoded using Illumina's Phred+64.

    Leave a comment:


  • jmugford
    started a topic Phred score of i

    Phred score of i

    Hi

    I have the following sequence off of a paired end HiSeq2000 run:

    @UNC11-SN627_0113:1:1101:1382:2135#0/1
    TTAAGGTTTTCACTGGTATAAATCTTTCTATATTGAGACAAAATTTAAGA
    +UNC11-SN627_0113:1:1101:1382:2135#0/1
    bbbeeeeegggggiiigiiiiiiiiiiiiiiiiiiihiiiihiiiiiiih

    I am trying to use FASTX to generate a box plot of phred quality scores and it cannot handle the score of "i". None of the scoring systems (sanger, illumina 1.x+, etc.) seem to use "i" as far as I can tell.

    Does anyone know what is happening here (what version I have here) and how I can generate a box plot like this would be extremely appreciated?

    Thanks
Working...
X