Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • swbarnes2
    replied
    You seem very confused.

    2 doesn't mean "mapped".
    It means "mapped in the proper pair". That means one forward, one reverse, with the distance between them being around the average insert size as comapred to the other reads in the project.

    DNA fragments don't know which direction you are calling forward, and which you are calling reverse. The adaptors just go on whatever end they can. So you can't expect all of read one to run in the direction that we by convention call "forward".

    If you made your fastqs as it looks like you did, with those two reads, both in the same direction, and made it look like they were paired by putting one each in a different fastq, then bwa did exactly as its supposed to. The reason it looks strange is because that would be a very strange pair of reads in a real experiment. Rev-comp one of them, and try again, and you will get better results.

    I'm not sure how bwa handles mate reads, I've never tried it. It might fail to flag them as properly paired, because they point out, instead of in, like paired ends. I suppose revcomping both fastqs (and reversing the quality strings) might allow bwa to flag them as properly paired.

    If you want all the reads where one end mapped, and one end didn't, you want all the reads with a 4 or an 8, but not both. 4 means "Did not map". 8 means "mate didn't map". Samtools view can filter like that.

    Leave a comment:


  • Tomi
    replied
    Thank you very much ! this explains it why it didnt work.

    Well, what does it mean: the second read? I though to be honest, that the second is read is meant as the reverse?!

    and do you also have magic numbers for mate reads? cause, I want to extract reads, were one strand is mapped and the other is not.

    thanks in advance

    Leave a comment:


  • swbarnes2
    replied
    No, you are misreading the flags. 65 = 64 +1, which means it's the first read, and it's paired. 129 = 128 + 1, meaning it's the second read, and it's paired. Both are in the forward direction. That's why they aren't properly paired. You can see that for yourself if you blat them.

    The magic numbers for flags for properly paired reads are 83,99,147,163

    Leave a comment:


  • Tomi
    started a topic Sam Flag 65 and 129 after BWA

    Sam Flag 65 and 129 after BWA

    Hi,

    I am trying to run BWA with a paired end simulated test data (Illumina and 75bp long).

    Basically I generated out of a reference Database an artifical sample and I am trying to verify the results of BWA.

    Unfortuneteley I am not very sure about the flags in the Sam file, I thought that mapped reads as a pair are displayed with the flag: 2

    But in my sam file i just get the flag (65 and 12), which describes:
    65: paired read and forward
    129: paired read and reverse

    But i thought that the flag for mapped (0x0002) will be set as well? So my question is, if there is something wrong in the sample or what flags do I have to use to extract the mapped reads from paired and from single-end data.

    This is an ouput from sampe:
    :
    @SQ SN:gi|157704448|ref|AC_000133.1| LN:219475005
    @PG ID:bwa PN:bwa VN:0.5.9-r16
    testSample_0_1 65 gi|157704448|ref|AC_000133.1| 1 37 75M = 151 150 ATTGACAAGGGGAGGGAAAAGAGGAACAGAAATTCTTTTCTAT$
    testSample_0_2 129 gi|157704448|ref|AC_000133.1| 151 37 75M = 1 -150 ATAACTTGGAAGCTTCCTTTAAAAGGAACATCAGGAGGTGATT$


    Greetings and many thanks,
    TOmoi

Latest Articles

Collapse

  • seqadmin
    New Genomics Tools and Methods Shared at AGBT 2025
    by seqadmin


    This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

    The Headliner
    The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
    03-03-2025, 01:39 PM
  • seqadmin
    Investigating the Gut Microbiome Through Diet and Spatial Biology
    by seqadmin




    The human gut contains trillions of microorganisms that impact digestion, immune functions, and overall health1. Despite major breakthroughs, we’re only beginning to understand the full extent of the microbiome’s influence on health and disease. Advances in next-generation sequencing and spatial biology have opened new windows into this complex environment, yet many questions remain. This article highlights two recent studies exploring how diet influences microbial...
    02-24-2025, 06:31 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 03-03-2025, 01:15 PM
0 responses
180 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-28-2025, 12:58 PM
0 responses
275 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-24-2025, 02:48 PM
0 responses
662 views
0 likes
Last Post seqadmin  
Started by seqadmin, 02-21-2025, 02:46 PM
0 responses
268 views
0 likes
Last Post seqadmin  
Working...
X