Convert FASTA to FASTAQ

[jomaco]

Hi

I need to map small RNA sequences onto a genome using BWA.

The read file (reads.fa) is in the following format:

>EMUNAOL01D19UY length 23 duplications 0
CGTCTTGGTTTGTCTAAAGGGGC
>EMUNAOL01EK9BY length 24 duplications 0
TGGTGGAGGCCCGCAGCGATACTG
>EMUNAOL02GZHTT length 24 duplications 0
GGGCAAAAGTACAAAGTTCATGTG
>EMUNAOL02IQUC1 length 24 duplications 0
AGAAATGTTGCTACATAAATTGGA

How can I convert this file to a FASTAQ file (reads.fastq) suitable for BWA?

I tried maq but I couldn't get it to work - it just produced a file of 0 bytes - so i'm not sure if it's suitable for what i'm trying to do. Is there another program might be useful?

Thanks

Jon

[lh3]

BWA accepts reads in the fasta format.

[jomaco]

Sorry. You're right it does. Someone who asked me to run the alignment told me it was required to convert the read file to fastaq format. Perhaps I should not be so trustful next time!

I have now managed to get the alignment to run. Thanks for your reply

[maubp]

What's this "FASTAQ" format? Do you mean "FASTQ"?

[lh3]

I believe "FASTAQ" is a typo, but actually fasta+fastq is really a fastaq format. You can mix fasta and fastq records in one file with no problem. A multi-line fastq parser can be trivially modified to parse such a file. This is basically what my fastq/fasta parser is doing. To most of my recent programs (maq excluded), fasta and fastq are the same format.

[maubp]

Mixing FASTA and FASTQ into one file... that strikes me as a strange and dangerous idea, although I can see uses for it (combining raw read datasets of different types into one file for alignment).

[lh3]

I am not saying this is a good format. I am saying that there should really be one parser instead of two.