Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • desmo
    replied
    Thanks. I've not yet decided what strategy is better for my work but yours suggestions were very useful

    Leave a comment:


  • simonandrews
    replied
    Originally posted by desmo View Post
    Hi everyone,
    I would like to know which are the most useful softwares to control the quality of short reads generated by different kinds of platform.
    I've just used FastQC but it's just a visual tool.
    Do anyone know similar softwares that make similar analisys, provide some informations about bad reads and filter them?
    Thanks
    I would be wary about automatically filtering anything which looked odd in a dataset. Some filtering (quality and adapter trimming) is uncontentious and programs like cutadapt seem to do a good enough job for that. Filtering on other measures within your library without actually looking at the data and putting this in the context of the experiment runs the risk of removing interesting biological effects.

    We've always said that the tests in FastQC are not intended to tell you whether your data is good or bad, they're there to tell you which aspects of your data you need to consider more closely, or bear in mind when interpreting the results of downstream analysis. We can provide examples of perfectly good sequence data which can fail any of the tests FastQC does.

    Leave a comment:


  • kga1978
    replied
    I have recently started using a combination of cutadapt and prinseq that seems to be working pretty well. Here's an example command that will trim all TruSeq adapters and low quality bases

    gunzip *.gz -c | cutadapt -O 6 2> reads.cutadap_log.txt -a AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTG -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTG -a CTTCACCGTGCCAGACTAGAGTCAAGCTCAACAGGGTCTTCTTTCCCCGCTG -a GGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCC -a CTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGTCCCTTCGGAA -a CGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGGGAA -a CCACTCTCGACTGCCGGCGACGGCCGGGTATGGGCCCGACGCTCCAGCGCCA -a TGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAAC -a CCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTACGGACCTC -a CACGAGCGCACGTGTTAGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGG -a GTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCC -a CTCCCGTCCACTCTCGACTGCCGGCGACGGCCGGGTATGGGCCCGACGCTCC -a CGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGGCGA -a GAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGG -a CAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGT -a TTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGTCCCTTCGGAACGGCG - | prinseq -fastq stdin -out_good stdout -log reads.prinseq_log.txt -min_len 20 -ns_max_n 4 -min_gc 10 -max_gc 90 -min_qual_mean 18 -trim_qual_left 10 -trim_qual_right 10 | gzip -9 > reads.trimmed.fastq.gz

    Leave a comment:


  • desmo
    started a topic Short-read quality control software.

    Short-read quality control software.

    Hi everyone,
    I would like to know which are the most useful softwares to control the quality of short reads generated by different kinds of platform.
    I've just used FastQC but it's just a visual tool.
    Do anyone know similar softwares that make similar analisys, provide some informations about bad reads and filter them?
    Thanks

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 07:20 AM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-16-2024, 05:49 AM
0 responses
36 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-15-2024, 06:53 AM
0 responses
39 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
41 views
0 likes
Last Post seqadmin  
Working...
X