Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problem Encountered When Using SOAPdenovo: Floating Point / Segmentation Error

    Hi, Dear Colleagues:
    I'm a student from Fudan University, and is currently trying to use SOAPdenovo to run de novo assemble on human mitochondrial genome sequencing data. These data are either downloaded from the 1000Genome Project website (which is sequenced by Illumina or SOLiD sequencers) or sequenced by our lab using Illumina HiSeq2000 sequencers. The coverage of reads are low to moderate, from 20x to 50x.
    The configuration of computer I used to run SOAPdenovo is as follows:
    Intel Core i7 Quad 2.3GHz, 8GB of RAM, 750GB HDD, Mac OS X 10.7.2 and running SOAPdenovo 1.05 ver 63.
    The problem I encountering is when I tried to using SOAPdenovo to construct scaffolds. I've tested different kmer values, from 13 (the minimum allowance of SOAPdenovo) to 43 (the maximum I can run on this computer), yet all of the tests have returned a "Segmentation fault: 11" or a "Floating point exception: 8" error.
    Furthermore, I found the contig constructed by SOAPdenovo is significantly smaller thant the 454 de novo assembler. The biggest contig constructed by SOAPdenovo is only about 600bp long, yet the biggest contig constructed by 454 de novo assembler is more than 7,000bp.
    To help you to analyze the problem, I've attached the configuration file, as well as the sample reads I've used, at the end of this post.
    Your kind reply will be quite appreciated.

    Thanks.


    Configuration File:
    max_rd_len=100
    [LIB]
    avg_ins=500
    reverse_seq=0
    asm_flags=3
    rank=1
    q1=/Users/AndyDing/Server/data/111121/NA19308_f.fq
    q2=/Users/AndyDing/Server/data/111121/NA19308_r.fq

    Sample Reads:
    @SRR042435.101073000/1
    ACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCC
    +
    ><5@A?>@B;A<B=>@<@@A<A<<<@@BC@B<=A<@;A<4<=;;;?797I
    @SRR042435.101149159/1
    GATGGATCACANNTCTATCACCCTATTAACCACTCACNNGAGCTCTNNAT
    +
    >AA?=AB:A<A!!?<A@B<A<=>A@AC?B<<A;@<@<!!>A;:?;?!!5I
    Last edited by andyding; 11-22-2011, 04:33 AM.

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
54 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
42 views
0 likes
Last Post seqadmin  
Working...
X