Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problem Encountered When Using SOAPdenovo: Floating Point / Segmentation Error

    Hi, Dear Colleagues:
    I'm a student from Fudan University, and is currently trying to use SOAPdenovo to run de novo assemble on human mitochondrial genome sequencing data. These data are either downloaded from the 1000Genome Project website (which is sequenced by Illumina or SOLiD sequencers) or sequenced by our lab using Illumina HiSeq2000 sequencers. The coverage of reads are low to moderate, from 20x to 50x.
    The configuration of computer I used to run SOAPdenovo is as follows:
    Intel Core i7 Quad 2.3GHz, 8GB of RAM, 750GB HDD, Mac OS X 10.7.2 and running SOAPdenovo 1.05 ver 63.
    The problem I encountering is when I tried to using SOAPdenovo to construct scaffolds. I've tested different kmer values, from 13 (the minimum allowance of SOAPdenovo) to 43 (the maximum I can run on this computer), yet all of the tests have returned a "Segmentation fault: 11" or a "Floating point exception: 8" error.
    Furthermore, I found the contig constructed by SOAPdenovo is significantly smaller thant the 454 de novo assembler. The biggest contig constructed by SOAPdenovo is only about 600bp long, yet the biggest contig constructed by 454 de novo assembler is more than 7,000bp.
    To help you to analyze the problem, I've attached the configuration file, as well as the sample reads I've used, at the end of this post.
    Your kind reply will be quite appreciated.

    Thanks.


    Configuration File:
    max_rd_len=100
    [LIB]
    avg_ins=500
    reverse_seq=0
    asm_flags=3
    rank=1
    q1=/Users/AndyDing/Server/data/111121/NA19308_f.fq
    q2=/Users/AndyDing/Server/data/111121/NA19308_r.fq

    Sample Reads:
    @SRR042435.101073000/1
    ACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCC
    +
    ><5@A?>@B;A<B=>@<@@A<A<<<@@BC@B<=A<@;A<4<=;;;?797I
    @SRR042435.101149159/1
    GATGGATCACANNTCTATCACCCTATTAACCACTCACNNGAGCTCTNNAT
    +
    >AA?=AB:A<A!!?<A@B<A<=>A@AC?B<<A;@<@<!!>A;:?;?!!5I
    Last edited by andyding; 11-22-2011, 04:33 AM.

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-13-2024, 08:58 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
184 views
0 likes
Last Post seqadmin  
Working...
X