how to remove 3'-adaptor sequence from illumina DGE expression data

[maasha]

Biopieces got find_adaptor which allows removal of partial adaptor sequence:

http://code.google.com/p/biopieces/wiki/find_adaptor

[archory]

thanks for the reply and I will try them first and see how things going

[kalyankpy]

Cutadapt

I have used Cutadapt (code.google.com/p/cutadapt/). I liked this tool as it allows user to define and fine tune each of the parametre. You can also allow errors in identifying the adapters. If in case you want to check the 5' adapters, this will be a tool of choice as you can specify where to search the adapter (3' or 5' or anywhere).

[kga1978]

I found this only yesterday - really nice tool:

http://www.usadellab.org/cms/index.php?page=trimmomatic

[archory]

thanks for the recommendation and I will try it

[Nicolas]

Did you try fastx_toolkit? It contains a script fastx_clipper that identify the 3'adapter and remove it. It allows for some mismatches and should correspond to what you're looking for.

http://hannonlab.cshl.edu/fastx_toolkit/

[archory]

I got the raw illumina DGE expression data in FASTQ format, and trying to remove the 3'-adaptor sequence from it.

here is samples of the raw data I got from the sequencing company
@FC81M3VABXX:4:1101:1130:2169#0/1
GGATCTGGTTGGGTTATCCAGTACTTCTCGTATGGCGTCTTCTGCTTGA
+
eceaeedec_bddI_c^bccebUecRc^cXXZ__L^BBBBBBBBBBBBB
@FC81M3VABXX:4:1101:1110:2188#0/1
TTCAGGTGGTTTCTTCTCCAGTACTTCTCGTATGCCGTCTTCTGCTTGA
+
gggggfdffdgggggggggdgggggggggedfeefffdfefd^aeefa^
@FC81M3VABXX:4:1101:1184:2239#0/1
GAACATCACTGTAGACTTCCAGTACTTCTCGTATGCCGTCTTCTGCTTG
+
fffffffffffefMfdddddffeffffeffe[db[eedbceecececd^

I can find the Gex Adapter 2 for NlaIII gene expression (TCGTATGCCGTCTTCTGCTTG) at the end of the sequence, but the problem is that the tag sequence shall be just 17bp and the remaining sequences doesn't seem to match the adapter 1.
anyone knows how to get the correct tag sequences from the sample fastq above?

many thanks!