FASTA Viewer

[Kennels]

If you are familiar with command line terminal, you could try grep in the command line:

grep "yoursequence" yourfastafile

Using the '-B 1' option will allow you to grab the header for this sequence too:

grep -B 1 "yoursequence" yourfastafile

if you have a text file with each sequence on each line you can use fgrep:

fgrep -B 1 -f filewithlistofsequences yourfastafile

These will produce an output to the screen if the sequence exists (or you could redirect to another file using '> output.txt'). Otherwise there will be no output. But the search will only be for exact matches, and will miss sequences with line breaks in between.

[colindaven]

Another, perhaps more user friendly approach for non bioinformaticians might be
Artemis from the Sanger Institute.

A good text editor, i.e. Notepad++ on Windows, might do the trick too, but watch out for
line breaks.

[arvid]

Legacy BLAST formatdb for nucleotide FASTA files:

formatdb -p F -i file.fasta

To search:

blastall -p blastn -d file.fasta -i query.fasta

Execute "formatdb --help" and "blastall --help" to see all options.

[ashkot]

Hi there,
I did run formatdb on my FASTA file but i am getting an error stating index file not found.

Do you know the exact syntax for formatdb to convert a .fasta file into a BLAST able .fasta database file.

Thanks in advance.
Ashwin

[arvid]

If you do a simple text search with a text editor, you might miss it since the file contains linebreaks.

I'd simply make a BLAST database out of the FASTA file and use BLAST to find the matching position.

[ashkot]

Hi,
I wanted to search for a sequence in a FASTA file, for e.g the sequence could be

GGTTCCGCTTTCCACTGCTGCCGCCAGTCGGCCTGAGATGCACTGGCCTCGGCCTCAGAGGAGGCAGTCGCTGACACCTGGCTCCAGGTCCTGGAATCCGGAGGGGCCTCTGGGCCACCGG

OR

GGTTCCGCTTTCCACTGCTGCCGCCAGTCGGCCTGAGATGCACTGGCCTCGGCCTCAGAGTAGGCAGTCGCTGACACCTGGCTCCAGGTCCTGGAATCCGGAGGGGCCTCTGGGCCACCGG

If the FASTA was viewable, then i could do a find for confirmation, i.e. to confirm that the searching code is working fine.

Does the program FASTA search for a sequence within a FASTA file.

Ashwin

[kmcarr]

Ashwin,

FASTA files are simply plain text files; they could be opened with any text editor. What do you wish to do with these files? There isn't really much to "look" at in a FASTA file, it's just a long string of DNA sequence (or RNA or protein).

[ashkot]

Hi all,
I have several large FASTA files and i wanted to know if there is a FASTA visualizer for Windows or Linux?

Thanks in advance.

Regards,
Ashwin