Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bowtie2 quality scores same for every read

    Dear all,

    I am trying to map Illumina 2x126bp exome data (Nimblegen v3) with bowtie2. Subsequently, I want to perform variant detection using Samtools.

    I ran into following problem:
    - When I do an end-to-end paired-end mapping with bowtie2, the resulting sam file shows a mapping quality (column 5, MAPQ) of 0 for every read.
    - When I do a local paired-end mapping with bowtie2, the resulting sam file shows a mapping quality (column 5, MAPQ) of 44 for every read.
    - Note: both end-to-end and local mapping of the same reads but as single end reads shows a MAPQ value ranging between 1 and 44 (local) or between 1 and 42 (end-to-end)

    Example sam output end-to-end:
    bowtie2 --very-sensitive -p 8 --no-mixed --no-discordant -x ./bowtie2_hg19/hg19 -1 F10_GCCAAT_L007_R1.fastq -2 F10_GCCAAT_L007_R2.fastq -S F10_ete.sam --met-file F10_ete.out
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 83 chr19 8841203 0 126M = 8841061 -268 TTAAGTTTTCTCCCTCCAGCCTACTGATTCTAGCTGCAGCCTCATTCCTCTTCTCAAGACACCATCCCAGGAAGCCACCACCAATCAATGATGATTGGCATGTGAGATGAAAATTATTTGCCACCC ####A?9(09.0?88B@A::A>@@>>@A@A>CA::BBBBCCCCA;6(67;7B?7==.)(=)GHFC@=8)<HEBD?700):FHGGFDF?GHGIHHG@IIGF<DH@<H@IGGHF<>FBCABDDDA@@@ AS:i:-4 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:46A31T47 YT:Z:CP
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 163 chr19 8841061 0 126M = 8841203 268 TGAGGCACCACGTCCGGCCGAACCTCAAATTTTTCACTATAGGGAGCAGTGGGTAGCTCTTCATTGGAGTGTGGCCAAGCGTCTCATTCAGAGATGCCAGCTGCTTCTTTGCCATCCCATGCCTTG @<@DFFFDBFBBFBGIIIGIJJJJ<9DH8DFGIIC8BGIEGHII>GIEE7=AA?BDCCCCA@CAA;CA?CDDDD?ACBB?BB?B?@DEECC::A@C4@A@BCC9CCCDDD((4@@A88:@C?::AC AS:i:-2 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:110C15 YT:Z:CP


    Example sam output local alignment:
    bowtie2 --very-sensitive-local --local -M 5 --score-min G,20,8 -p 8 --no-mixed --no-discordant -x ./bowtie2_hg19/hg19 -1 F10_GCCAAT_L007_R1.fastq -2 F10_GCCAAT_L007_R2.fastq -S F10_local.sam --met-file F10_local.out
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 83 chr19 8841203 44 126M = 8841061 -268 TTAAGTTTTCTCCCTCCAGCCTACTGATTCTAGCTGCAGCCTCATTCCTCTTCTCAAGACACCATCCCAGGAAGCCACCACCAATCAATGATGATTGGCATGTGAGATGAAAATTATTTGCCACCC ####A?9(09.0?88B@A::A>@@>>@A@A>CA::BBBBCCCCA;6(67;7B?7==.)(=)GHFC@=8)<HEBD?700):FHGGFDF?GHGIHHG@IIGF<DH@<H@IGGHF<>FBCABDDDA@@@ AS:i:244 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:46A31T47 YT:Z:CP
    HISEQ:126:C0HL2ACXX:7:1101:5336:1952 163 chr19 8841061 44 126M = 8841203 268 TGAGGCACCACGTCCGGCCGAACCTCAAATTTTTCACTATAGGGAGCAGTGGGTAGCTCTTCATTGGAGTGTGGCCAAGCGTCTCATTCAGAGATGCCAGCTGCTTCTTTGCCATCCCATGCCTTG @<@DFFFDBFBBFBGIIIGIJJJJ<9DH8DFGIIC8BGIEGHII>GIEE7=AA?BDCCCCA@CAA;CA?CDDDD?ACBB?BB?B?@DEECC::A@C4@A@BCC9CCCDDD((4@@A88:@C?::AC AS:i:248 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:110C15 YT:Z:CP

    Who can make sense of this? Thanks! I already spend a day on this.

    Kind regards,
    Filip

  • #2
    I want to bump this question. Mapping paired-end reads with bowtie2 should be common practice. Right? I cannot imagine that nobody elso ran in to this problem. Am I overlooking something really obvious? In the mean time, I helped myself by switching to bwa. I still want to make the bowtie2 approach work, because of speed issues and the local aligment features. Where are the Bowtie aficionados?

    Comment


    • #3
      Hi Filip,

      The same problem here (end to end, MapQual all 0s. However, this only happened when --no-mixed --no-discordant options were used. Find the parameters below:

      bowtie2 -p 6 --phred33 -N 1 -L 25 -X 650 -I 0 --no-mixed --no-discordant --un-conc ****_un.fastq --al-conc ****_al.fastq --rg-id Flowcell1_Lane4 --rg LB:Lib-**** --rg SM:*** --rg PL:HiSeq2000 -x $bowtie2_reference_dir/genome -1 $rawi/****_1.fq -2 $rawi/****_2.fq -S ****.sam >> ****.out 2>&1

      I found no issues when run in --non-mixed mode only. Find commands below:

      bowtie2 -p 6 --phred33 -N 1 -L 25 -X 650 -I 0 --no-mixed --rg-id Flowcell1_Lane4 --rg LB:Lib-**** --rg SM:*** --rg PL:HiSeq2000 -x $bowtie2_reference_dir/genome -1 $rawi/****_1.fq -2 $rawi/****_2.fq -S ****.sam >> ****.out 2>&1

      I hope this helps.

      Cheers,

      Fernando

      Comment


      • #4
        Thanks Fernando! Indeed, the problem only occurs when using --no-mixed and --no-discordant. I reported this bug to the sourceforge.net site.

        Comment


        • #5
          Excellent! Thanks.
          Cheers,
          Fernando

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Exploring the Dynamics of the Tumor Microenvironment
            by seqadmin




            The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
            07-08-2024, 03:19 PM
          • seqadmin
            Exploring Human Diversity Through Large-Scale Omics
            by seqadmin


            In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
            06-25-2024, 06:43 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, Yesterday, 05:49 AM
          0 responses
          12 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-15-2024, 06:53 AM
          0 responses
          23 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-10-2024, 07:30 AM
          0 responses
          36 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 07-03-2024, 09:45 AM
          0 responses
          204 views
          0 likes
          Last Post seqadmin  
          Working...
          X