Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • fastx_toolkit can't work

    when i use fastx_toolkits ,just like fastq_quality_filter:

    $ fastq_quality_filter -q 5 -p 50 -i ./SampleS_1.fq -o ./SampleSfilter_1.fq

    unfortunately,it returns as:

    fastq_quality_filter: Invalid quality score value (char '#' ord 35 quality value -29) on line 4

    how can I solve it ?

  • #2
    The program is using solexa quality scores (starting at 64) instead of sanger (starting at 33). According to the fastx website, support for sanger quality scores was added in version 0.0.13. Which version are you running?

    Comment


    • #3
      Try the command line option -Q 33 to indicate Sanger phred scores. That option has worked for me in the past

      Comment


      • #4
        Originally posted by Alex Renwick View Post
        The program is using solexa quality scores (starting at 64) instead of sanger (starting at 33). According to the fastx website, support for sanger quality scores was added in version 0.0.13. Which version are you running?
        i use the version 0.0.13,but it doesn't work too,how can i convert sanger fastq to illumina fastq format?

        Comment


        • #5
          Originally posted by dfjenkins3 View Post
          Try the command line option -Q 33 to indicate Sanger phred scores. That option has worked for me in the past
          i add this option ,but another error is happened like:

          fastq_quality_filter: Invalid quality score value (char 'J' ord 74 quality value 41) on line 4

          Comment


          • #6
            Can you post a few (12) lines of your FastQ file?

            Comment


            • #7
              I always thought it was -Q33... Does -Q 33 work?

              [edit] Oh, yes, it does.

              Comment


              • #8
                Originally posted by sisch View Post
                can you post a few (12) lines of your fastq file?
                @hwi-st298:170:81mg3abxx:1:1101:1349:2455 1:n:0:ttaggc
                ctggttcagccttcttaggctcttcttctgtttccttacctcagatcggaagagcacacgtctgaactccagtcacttaggcatttcgtatgacgtatgt
                +
                cccfffffghghfhgiijjfhegi?fhiihfchggggcegggicgebchfhgdhgiiibaf@fh7@@e;7=a;aadd>ccbcca################
                @hwi-st298:170:81mg3abxx:1:1101:1372:2461 1:n:0:ttaggc
                agacggtgttgcataagctgttgtatctgttgctgttgaaactgaaactgctgctgttgctgcttttgttttttagatcggcagggcacacgtgtgcgac
                +
                @@@fff@dfhgff<gaeehggg@@ehafhiiibgg<?ff<?<bf<fg@gg?be<<3?88bf#######################################
                @hwi-st298:170:81mg3abxx:1:1101:1866:2486 1:n:0:ttaggc
                gtcactttgtacctcttctcaaattaggaaaatacgaagttcgaggaacgcctttcgttctctttttttcttggtcggcagggtcagggcctttcttgct
                +
                @@cdffffdddhhegeggeegeh>hhhiigiij>ffcgggeghid0?dfdfggiig1=;;ceggcac<<ce@a@>>>;??>95(9<(38<?<a#######

                Comment


                • #9
                  Originally posted by letusgo View Post
                  i add this option ,but another error is happened like:

                  fastq_quality_filter: Invalid quality score value (char 'J' ord 74 quality value 41) on line 4
                  letusgo,

                  Are you sure that you are using v. 0.0.13? See this response to a thread about this issue from last year. (Hint, try searching the forum first, your question may already have been answered.) Using v. 0.0.13 and the '-Q 33' option together should work. If it doesn't then your FASTQ file may be malformed.

                  Comment


                  • #10
                    Originally posted by mgogol View Post
                    I always thought it was -Q33... Does -Q 33 work?

                    [edit] Oh, yes, it does.
                    unfortunately,it doesn't work for my fastq files,then i convert the sanger fastq to illumina fastq.when i run fastq_quality_filter,another error :

                    fastq_quality_filter: Invalid quality score value (char 'i' ord 105 quality value 41) on line 4

                    Comment


                    • #11
                      Originally posted by letusgo View Post
                      @hwi-st298:170:81mg3abxx:1:1101:1349:2455 1:n:0:ttaggc
                      ctggttcagccttcttaggctcttcttctgtttccttacctcagatcggaagagcacacgtctgaactccagtcacttaggcatttcgtatgacgtatgt
                      +
                      cccfffffghghfhgiijjfhegi?fhiihfchggggcegggicgebchfhgdhgiiibaf@fh7@@e;7=a;aadd>ccbcca################
                      @hwi-st298:170:81mg3abxx:1:1101:1372:2461 1:n:0:ttaggc
                      agacggtgttgcataagctgttgtatctgttgctgttgaaactgaaactgctgctgttgctgcttttgttttttagatcggcagggcacacgtgtgcgac
                      +
                      @@@fff@dfhgff<gaeehggg@@ehafhiiibgg<?ff<?<bf<fg@gg?be<<3?88bf#######################################
                      @hwi-st298:170:81mg3abxx:1:1101:1866:2486 1:n:0:ttaggc
                      gtcactttgtacctcttctcaaattaggaaaatacgaagttcgaggaacgcctttcgttctctttttttcttggtcggcagggtcagggcctttcttgct
                      +
                      @@cdffffdddhhegeggeegeh>hhhiigiij>ffcgggeghid0?dfdfggiig1=;;ceggcac<<ce@a@>>>;??>95(9<(38<?<a#######
                      O.K. I missed this before. Clearly your quality lines are malformed; are these after you converted them? You have ASCII values ranging from 35 (#) to 105 (i). No valid FASTQ files for Illumina reads uses a range this wide.

                      Comment


                      • #12
                        Originally posted by kmcarr View Post
                        O.K. I missed this before. Clearly your quality lines are malformed; are these after you converted them? You have ASCII values ranging from 35 (#) to 105 (i). No valid FASTQ files for Illumina reads uses a range this wide.
                        they come from a seqencing company,i didn't convert them.but when i convert them to Illumina fastq,their ASCII values is also malformed,what can i do?

                        Comment


                        • #13
                          Originally posted by letusgo View Post
                          they come from a seqencing company,i didn't convert them.but when i convert them to Illumina fastq,their ASCII values is also malformed,what can i do?
                          Ask the company what they did to create such data..?

                          Comment


                          • #14
                            Just curious, I googled the unique machine id: hwi-st298.
                            And I found this:
                            http://seqanswers.com/forums/showthread.php?t=15928
                            It looks that the company triggered the malformation not the first time.
                            Which company it is? BGI?

                            Comment

                            Latest Articles

                            Collapse

                            • seqadmin
                              Advanced Tools Transforming the Field of Cytogenomics
                              by seqadmin


                              At the intersection of cytogenetics and genomics lies the exciting field of cytogenomics. It focuses on studying chromosomes at a molecular scale, involving techniques that analyze either the whole genome or particular DNA sequences to examine variations in structure and behavior at the chromosomal or subchromosomal level. By integrating cytogenetic techniques with genomic analysis, researchers can effectively investigate chromosomal abnormalities related to diseases, particularly...
                              09-26-2023, 06:26 AM
                            • seqadmin
                              How RNA-Seq is Transforming Cancer Studies
                              by seqadmin



                              Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...
                              09-07-2023, 11:15 PM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by seqadmin, Yesterday, 09:38 AM
                            0 responses
                            9 views
                            0 likes
                            Last Post seqadmin  
                            Started by seqadmin, 09-27-2023, 06:57 AM
                            0 responses
                            11 views
                            0 likes
                            Last Post seqadmin  
                            Started by seqadmin, 09-26-2023, 07:53 AM
                            1 response
                            23 views
                            0 likes
                            Last Post seed_phrase_metal_storage  
                            Started by seqadmin, 09-25-2023, 07:42 AM
                            0 responses
                            17 views
                            0 likes
                            Last Post seqadmin  
                            Working...
                            X