Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • lv06025158
    replied
    About svtype in vcf file

    Originally posted by caswater View Post
    just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
    couldn't find any clue from pindel website.

    Thank you
    Dear everyone,
    I recently was doing something about genome-wide polymorphism detection, and one of my colleague recommended me to use pindel to get structure variation of re-seq data against reference genome. Here is my question: what does the SVTYPE=RPL in the vcf file stand for?
    Your answer will be useful to me. Thank you!

    Leave a comment:


  • caswater
    replied
    Thank you, Heisman. I just emailed the author, and will update you if there is any response.

    Leave a comment:


  • Heisman
    replied
    Then perhaps I'm a bit confused. The Pindel authors are nice/quick with responses to email inquiries; I'd just email the contact author if I were you.

    Leave a comment:


  • caswater
    replied
    Hi, Thanks a lot for your reply. I ran pindel and was got confused by the first SV output marked with RPL - e.g.

    line306 frameshift substitution KIAA1751:NM_001080484:exon18:c.2194_2215CCAAGCCAGGGTGGGCGGGG, chr1 1887091 1887112 CGCCCGCCCACCCTGGCTTGGC CCCCGCCCACCCTGGCTTGG

    If we align the 2 sequences (ref and alt), apparently it results from a G-deleteion at the 2nd base from the reference sequence. but pindel said it is a RPL

    I ran GATK, which also reported this SV but correctly identified this SV as 'deletion' -
    line253 frameshift deletion KIAA1751:NM_001080484:exon18:c.2214delC.G738fs, chr1 1887092 1887092 G

    I am just not sure if this is because of what I've missed in RPL definition, or because the program was confused by the alignment.

    Leave a comment:


  • Heisman
    replied
    I think that's when there are multiple successive bases that are changed, ie, if the reference sequence is:

    AGCGAG,TGAT,GAC

    Then the variant sequence could be

    AGCGAG,CTA,GAC

    At least that's what I remember thinking it was long ago; if that makes no sense then let me know as I could be mistaken for sure.

    Leave a comment:


  • caswater
    started a topic a quick question about SV type in pindel?

    a quick question about SV type in pindel?

    just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
    couldn't find any clue from pindel website.

    Thank you

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
25 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
59 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
45 views
0 likes
Last Post seqadmin  
Working...
X