a quick question about SV type in pindel?

[lv06025158]

About svtype in vcf file

just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
couldn't find any clue from pindel website.

Thank you

Dear everyone,
I recently was doing something about genome-wide polymorphism detection, and one of my colleague recommended me to use pindel to get structure variation of re-seq data against reference genome. Here is my question: what does the SVTYPE=RPL in the vcf file stand for?
Your answer will be useful to me. Thank you!

[caswater]

Thank you, Heisman. I just emailed the author, and will update you if there is any response.

[Heisman]

Then perhaps I'm a bit confused. The Pindel authors are nice/quick with responses to email inquiries; I'd just email the contact author if I were you.

[caswater]

Hi, Thanks a lot for your reply. I ran pindel and was got confused by the first SV output marked with RPL - e.g.

line306 frameshift substitution KIAA1751:NM_001080484:exon18:c.2194_2215CCAAGCCAGGGTGGGCGGGG, chr1 1887091 1887112 CGCCCGCCCACCCTGGCTTGGC CCCCGCCCACCCTGGCTTGG

If we align the 2 sequences (ref and alt), apparently it results from a G-deleteion at the 2nd base from the reference sequence. but pindel said it is a RPL

I ran GATK, which also reported this SV but correctly identified this SV as 'deletion' -
line253 frameshift deletion KIAA1751:NM_001080484:exon18:c.2214delC.G738fs, chr1 1887092 1887092 G

I am just not sure if this is because of what I've missed in RPL definition, or because the program was confused by the alignment.

[Heisman]

I think that's when there are multiple successive bases that are changed, ie, if the reference sequence is:

AGCGAG,TGAT,GAC

Then the variant sequence could be

AGCGAG,CTA,GAC

At least that's what I remember thinking it was long ago; if that makes no sense then let me know as I could be mistaken for sure.

[caswater]

just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
couldn't find any clue from pindel website.

Thank you