Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • a quick question about SV type in pindel?

    just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
    couldn't find any clue from pindel website.

    Thank you

  • #2
    I think that's when there are multiple successive bases that are changed, ie, if the reference sequence is:


    Then the variant sequence could be


    At least that's what I remember thinking it was long ago; if that makes no sense then let me know as I could be mistaken for sure.


    • #3
      Hi, Thanks a lot for your reply. I ran pindel and was got confused by the first SV output marked with RPL - e.g.

      line306 frameshift substitution KIAA1751:NM_001080484:exon18:c.2194_2215CCAAGCCAGGGTGGGCGGGG, chr1 1887091 1887112 CGCCCGCCCACCCTGGCTTGGC CCCCGCCCACCCTGGCTTGG

      If we align the 2 sequences (ref and alt), apparently it results from a G-deleteion at the 2nd base from the reference sequence. but pindel said it is a RPL

      I ran GATK, which also reported this SV but correctly identified this SV as 'deletion' -
      line253 frameshift deletion KIAA1751:NM_001080484:exon18:c.2214delC.G738fs, chr1 1887092 1887092 G

      I am just not sure if this is because of what I've missed in RPL definition, or because the program was confused by the alignment.


      • #4
        Then perhaps I'm a bit confused. The Pindel authors are nice/quick with responses to email inquiries; I'd just email the contact author if I were you.


        • #5
          Thank you, Heisman. I just emailed the author, and will update you if there is any response.


          • #6
            About svtype in vcf file

            Originally posted by caswater View Post
            just saw several SVs are marked with SVTYPE=RPL - what does RPL stand for?
            couldn't find any clue from pindel website.

            Thank you
            Dear everyone,
            I recently was doing something about genome-wide polymorphism detection, and one of my colleague recommended me to use pindel to get structure variation of re-seq data against reference genome. Here is my question: what does the SVTYPE=RPL in the vcf file stand for?
            Your answer will be useful to me. Thank you!


            Latest Articles


            • seqadmin
              Recent Advances in Sequencing Analysis Tools
              by seqadmin

              The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
              05-06-2024, 07:48 AM
            • seqadmin
              Essential Discoveries and Tools in Epitranscriptomics
              by seqadmin

              The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
              04-22-2024, 07:01 AM





            Topics Statistics Last Post
            Started by seqadmin, 05-14-2024, 07:03 AM
            0 responses
            Last Post seqadmin  
            Started by seqadmin, 05-10-2024, 06:35 AM
            0 responses
            Last Post seqadmin  
            Started by seqadmin, 05-09-2024, 02:46 PM
            0 responses
            Last Post seqadmin  
            Started by seqadmin, 05-07-2024, 06:57 AM
            0 responses
            Last Post seqadmin  