Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • 150 bps Read Length Issue

    I am doing some experiment with BowTie. Now, I want to do experiment with 150 bps read length. So, I download it from here. And converted to fastq format. Now, I see, the fastq format looks like,

    @ERR103405.1 M10_151:1:2:12250:1321 length=302 ATTTACTGCCTTGTGTCTCCAGTGCGCTGAAAATACCTTTATCTTGAAATAAGTTAACTAACTCTTGGATACCTTTAATTAATGCTGGGTTACCACCAGAAATTGTAACGTGGTTAAATAAATCGCCACCAATACGTTTTAATTCATCATAGAACAGCTGGATGTGATTATCGCTGTAGCTGGTGTGATTCTGCATTTACTTGGGATGGTAGTGCTAAAGGCGATATAAAACTCATGACCGCTGAAGAAATTTATGATGAATTAAAACGTATTGGTGGCGATTTATTTAACCACGTTACAAT
    +ERR103405.1 M10_151:1:2:12250:1321 length=302 CCCFFFFFHHHHHHHIHJJJJJIIJJIJJIJJJIIGJJJJIIGIJJHIGIIJJIIIJIIJJIJEIJIJFIIIFJGHHGHHFFFFFFFEDCCACCDA?ABDDDDDDCDC@?<ABBBDDDDEDDDC<?B?@BDDDDDB>CC@C:>AADDCACDB@CFFFDDHHBFHEHIIIIIGJIHHEGHIIHE1C?D?GGGIIIIGIFI>BHHIJ@3CHBDGGICHGEHIIGHE>BEDEDE;ACCDDCCA?B=BBCDCCCC@@>>C@CDC>@DCDCDDD<<@?AC(2??BDBDBCDCDDCC::?881<?C>:
    Now in NCBI, they described it as "DNA for paried end (150bp) sequencing on an illumina MiSeq". But here it looks it is 302 bps read. Can anybody help me why it is given in above sequence, "length=302" while it is written in the page that it is a 150 bps read.

  • #2
    It's a paired end 151 cycle read

    Comment


    • #3
      Originally posted by NextGenSeq View Post
      It's a paired end 151 cycle read
      Thanks. But, I want to give input 150 bps length read to Bowtie Tool. So, what I should do ? I search for 150 bp and get those as result.

      Comment


      • #4
        For technical reasons, the error rates are higher for the last base. Those can be removed with a variety of tools (e.g., Trimmomatic). I suggest you search the wiki.

        Comment


        • #5
          Originally posted by HESmith View Post
          For technical reasons, the error rates are higher for the last base. Those can be removed with a variety of tools (e.g., Trimmomatic). I suggest you search the wiki.
          Thanks. But, it is not possible to get 150 bps read length .sar file and fed it into Bowtie ? Another point is: here (http://www.ncbi.nlm.nih.gov/sra/SRX145461) it says 1 forward, 151 reverse. Can you inform does it mean ?

          Comment


          • #6
            Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base). Paired-end sequencing doubles the number of cycles: 2x151=302. SRA contains the raw (i.e., untrimmed) data.

            Comment


            • #7
              Originally posted by HESmith View Post
              Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base). Paired-end sequencing doubles the number of cycles: 2x151=302. SRA contains the raw (i.e., untrimmed) data.
              Is paired end read (or 1 forward, 151 reverse) means first end is taken from DNA's forward stand and second one taken from DNA's reverse strand ? Means are they reverse complement ? Sorry, I have very little idea about Bioinformatics. Another point is,

              "Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base)" - is this means last base of 151 bps should be dropped by the tool ?

              Comment


              • #8
                The answers to your questions can be found by searching the forum.

                Comment

                Latest Articles

                Collapse

                • seqadmin
                  Advanced Methods for the Detection of Infectious Disease
                  by seqadmin




                  The recent pandemic caused worldwide health, economic, and social disruptions with its reverberations still felt today. A key takeaway from this event is the need for accurate and accessible tools for detecting and tracking infectious diseases. Timely identification is essential for early intervention, managing outbreaks, and preventing their spread. This article reviews several valuable tools employed in the detection and surveillance of infectious diseases.
                  ...
                  Yesterday, 01:15 PM
                • seqadmin
                  Strategies for Investigating the Microbiome
                  by seqadmin




                  Microbiome research has led to the discovery of important connections to human and environmental health. Sequencing has become a core investigational tool in microbiome research, a subject that we covered during a recent webinar. Our expert speakers shared a number of advancements including improved experimental workflows, research involving transmission dynamics, and invaluable analysis resources. This article recaps their informative presentations, offering insights...
                  11-09-2023, 07:02 AM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by seqadmin, Yesterday, 08:12 AM
                0 responses
                14 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 11-22-2023, 09:29 AM
                1 response
                46 views
                0 likes
                Last Post VilliamPast  
                Started by seqadmin, 11-22-2023, 08:53 AM
                0 responses
                30 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 11-21-2023, 08:24 AM
                0 responses
                23 views
                0 likes
                Last Post seqadmin  
                Working...
                X