Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • rboettcher
    replied
    @bostonian

    I am currently struggling with the same issue, did you find a solution for your problem?

    Leave a comment:


  • westerman
    replied
    @bostonian

    I do not use ShortRead however reading the manual ShortRead uses the readAligned part of bioconductor. I am not sure that readAligned will read in your file directly however the fields are similar and I suspect that with some simple data manipulation you could get them read in.


    BTW: It is this type of data manipulation that makes bioinformatics such a joy. :-)

    Leave a comment:


  • dpryan
    replied
    As Rick suggested and they state in the data processing section of each sample, the files are from the Genome Analyzer Pipeline (there are two files for each sample, since this is paired-end data). If you were willing to redo the alignment, you can download the reads from SRA and convert them to fastq with fastq-dump. Alternatively, it wouldn't be difficult to write a small program in perl/python/R/whatever to read in both read files at once and output to SAM. Just make sure that corresponding lines in each file are actually meant to go together (that is, ensure that read names match), as if they kept reads where only one end maps then you would otherwise get really screwy results. So, just put a * in the base quality field and make up an appropriate fake MAPQ value along with the correct flag and you're good to go.

    Leave a comment:


  • bostonian
    replied
    Thank, Rick. I am trying to avoid doing alignment myself. Since each sequence comes with chromosome number and genomic coordinates in the data file, I assume they are already aligned (?). Is there any tool that I can use to convert the data into some format so that I can read them into some R packages, such as ShortRead or others (?), for further analysis?

    Leave a comment:


  • westerman
    replied
    I believe that these are output from "Illumina Genome Analyzer Pipeline". I am not sure if there is a converter from this format to SAM/BAM. Multi-fastA would be trivial. Something like:

    cut -f 1,2 file.name | sed -e 's/^/>/' -e 's/\t/\n' > output.file

    or

    perl -nale 'print ">$F[0]\n$F[1]"' file.name > output.file

    Then you could map the reads against a current human genome and go from there.

    Leave a comment:


  • bostonian
    replied
    Hi, Thanks a lot for your response. The dataset is GSE22260. I do not see any mentioning about the data formet, but maybe it is only because I do not know where to look. Could you also advise how to convert what I have to SAM/BAM format? or how to convert to multi-fasta files? I am fairly familiar with R, so I am hoping I will be able figure the later analysis after I have data in BAM format. Thanks again.

    Leave a comment:


  • dpryan
    replied
    It'd help if you mentioned the GEO accession number. They probably mention more about the format in the GEO entry. If nothing else, you could probably convert that to SAM/BAM format (the difficulty being whether or not the mappings are actually unique) and then calculate the RPKM. Alternatively, if they provide no further information (or the original fastq file), you could convert that to a multi-fasta file and then realign it.

    Leave a comment:


  • bostonian
    started a topic data format and how to analysis

    data format and how to analysis

    Hi,

    I am a complete newbie, so please bear with me if my question seems too silly.

    I recently downloaded a RNAseq dataset from GEO, it contains paired data files, and in the following format:

    readID Seq 0-mi**** 1-mi**** 2-mi**** chr start end strand
    HWUSI-EAS230-R:2:99:1151:1802#0/1 GAGCTCATTGGTGGCGTGGTGGCCTTGACCTTCCGG 1 0 0 chr10 70914936 70914971 -
    HWUSI-EAS230-R:2:44:642:495#0/1 TTGGCTGCCTTCTGGGGTGAACTTTCTGCTATTTCC 0 0 1 chr7 47298110 47298145 -

    ......

    I googled around but could not figure out what format it is, and how to proceed to analyze. My goal is to produce gene expression values (RPKM) from these data files.

    Thanks so much for your help.

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM
  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-10-2024, 06:35 AM
0 responses
44 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-09-2024, 02:46 PM
0 responses
54 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-07-2024, 06:57 AM
0 responses
43 views
0 likes
Last Post seqadmin  
Working...
X