Seqanswers Leaderboard Ad
Collapse
Announcement
Collapse
No announcement yet.
X
-
Easiest way to fix this is to use seqret in emboss. Just convert the fasta file to ncbi style fasta and it automatically fixes the issue.
-
Originally posted by baohua100 View Post$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
[fai_build_core] different line length in sequence 'scaffold_28'.
Leave a comment:
-
Originally posted by maubp View PostJust for anyone interested here is the Biopython equivalent:
Code:from Bio import SeqIO SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")
Leave a comment:
-
I had the same sort of segmentation fault. There were no blank lines in my file though. It was apparently due to one of my sequences being >65535 bp (though I don't know why that should matter).
Maubp's biopython code took care of it nicely. Thanks!
Leave a comment:
-
Ah - blank lines at the end of the file can be easily overlooked.
In principle I believe that faidx can cope with blank lines *between* records, but I haven't made time to work out the required code changes to do this. It would probably save some general aggravation though
Leave a comment:
-
Originally posted by jdjax View PostHello, I am coming across the same error. However I have tried that Bio script posted above and it did not work stating some error.
I then looked at my fasta file in vim and it does not have any blank lines in the file.
Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?
Thank you in advance for your help.
Leave a comment:
-
Originally posted by michmich View PostThe problem is that your FASTA file has a blank lines in it.
you need to get rid of them!!!
you can :g/^$/d in vi/vim editor.
I then looked at my fasta file in vim and it does not have any blank lines in the file.
Does any one have a suggestion of how to fix this problem so that I can use samtools faidx common on my fasta file?
Thank you in advance for your help.
Leave a comment:
-
The problem is that your FASTA file has a blank lines in it.
you need to get rid of them!!!
you can :g/^$/d in vi/vim editor.
Leave a comment:
-
Hello, I have the same problem. I found the last lines in fa file likes:
Code:ggttagggtgtggtgtgtgggtgtgtgtgggtgtggtgtgtgtgggtgtg gtgtgtgggtgtgggtgtgggtgtgggtgtgtgggtgtggtgtgtgggtg tggT
My question is that can I manually modify instead of using a software.
I don't want to install too many software because of rare usage.
Thanks.
Leave a comment:
-
I faced the same problem, but solved with webbrewer's code!
Originally posted by webbrewer View PostThis bioperl snippet fixes the fasta:
Code:use Bio::SeqIO; $in = Bio::SeqIO->new(-file => "inputfilename", -format => 'Fasta'); $out = Bio::SeqIO->new(-file => ">outputfilename", -format => 'Fasta'); while ( my $seq = $in->next_seq() ) {$out->write_seq($seq); }
Leave a comment:
-
Originally posted by webbrewer View PostThis bioperl snippet fixes the fasta
Code:from Bio import SeqIO SeqIO.convert("inputfilename.fas", "fasta", "outputfilename.fas", "fasta")
Leave a comment:
-
Thanks very much webbrewer for your bioperl fix, it worked perfectly.
Leave a comment:
-
Originally posted by baohua100 View Postpopulus@Rust:~/samtools-0.1.5c_x86_64-linux$ ./samtools faidx /media/Poplar/baohua/genome/poplar_genome.fa
[fai_build_core] different line length in sequence 'scaffold_28'.
Segmentation fault
What's the meaning of defferent line length ?
Leave a comment:
Latest Articles
Collapse
-
by seqadmin
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...-
Channel: Articles
Yesterday, 07:01 AM -
-
by seqadmin
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...-
Channel: Articles
04-04-2024, 04:25 PM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, 04-11-2024, 12:08 PM
|
0 responses
59 views
0 likes
|
Last Post
by seqadmin
04-11-2024, 12:08 PM
|
||
Started by seqadmin, 04-10-2024, 10:19 PM
|
0 responses
57 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 10:19 PM
|
||
Started by seqadmin, 04-10-2024, 09:21 AM
|
0 responses
48 views
0 likes
|
Last Post
by seqadmin
04-10-2024, 09:21 AM
|
||
Started by seqadmin, 04-04-2024, 09:00 AM
|
0 responses
55 views
0 likes
|
Last Post
by seqadmin
04-04-2024, 09:00 AM
|
Leave a comment: