Header Leaderboard Ad

Collapse

Problematic Fastq qualities with BWA

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problematic Fastq qualities with BWA

    Hi all,

    I'm having problems running BWA (0.5.9-r16 and 0.6.2) on some new whole exome data.

    The initial alignment runs fine (it seems) but when I want to create a SAM file with 'bwa sampe' it screws up the quality scores. Reading the file with samtools gives this error:
    [samopen] SAM header is present: 25 sequences.
    Parse error at line 27: sequence and quality are inconsistent
    This is the first sequence line of the SAM file:
    HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 60 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG ^_^_$^]^SESC ^\ ^Y# ^_^V^\^W $"#$!#" ^^
    ^X^^
    Compared to an equivalent output from bowtie2:
    @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta7
    HISEQ1:382:C14EVACXX:3:1101:1296:1986 83 1 212274224 42 101M = 212274087 -238 AAAGCTGTGGAACGCTACCTCTTCCTTTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGGTTGTTG >>C<2;(8B?>5;6([email protected]?=)7=)7;CIIHEHIGIGC=?BD<@GE>GBB3DEF9AIIIIIGGGGHF?D6E9DHGHCHCBIFF<>FHDDB=:;?1 AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:101 YS:i:0 YT:Z:CP
    Anyone else seen this? Is this a problem caused by an incompatibility between BWA and casava 1.8+? I've run BWA in the past with no problems.
    TIA

  • #2
    Bump. Am I the only one seeing this?

    Comment


    • #3
      I had similar issues with bwa, switched to bowtie2 like you did

      Comment


      • #4
        Please write down the command line of BWA. Not just the sampe part, but the aln part also. Usually I get this kind of results when I use -I option in bwa aln.
        Other tip: See the next line after the error (in your case line 28). Maybe a newline character can be found on your quality score?

        Comment


        • #5
          I thought this was a dead thread so didn't update.

          Problem is/was the '-I' switch in bwa. It doesn't work with newer sanger fastq format files produced with Illumina pipeline v1.8+: remove switch and it works.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
            by seqadmin


            ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

            01-24-2023, 01:19 PM
          • seqadmin
            Introduction to Single-Cell Sequencing
            by seqadmin
            Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

            The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
            ...
            01-09-2023, 03:10 PM

          ad_right_rmr

          Collapse
          Working...
          X