Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • ugolino
    replied
    To align reads with greater confidence, as these strains have many phages and IS elements ( some of which are chromosomal in certain strains and plasmid borne in others ), and their genomes have not been sequenced yet ( so I also sequenced the genomes ).

    Leave a comment:


  • ThePresident
    replied
    Simple curiosity (since I've also done RNA-seq on some bacterial species), why have you chosen to do your study with paired-end sequencing?

    TP

    Leave a comment:


  • ugolino
    replied
    I think I figured it out. Bowtie2 outputs by default reads sorted by name. The offending part in the reads is the _1, _2 at the end. Removing those (in vim) fixed the problem and htseq-count works without any sorting needed. Only after couple hours of staring at the reads to figure this out, came across this thread that explains an identical issue. Feeling slow...

    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc


    thanks

    Leave a comment:


  • ugolino
    started a topic convert sorted bam to sorted sam for htseq-count

    convert sorted bam to sorted sam for htseq-count

    Hi there,

    I have a bowtie2 alignment of PE non-stranded RNA-seq reads from a bacterial species (used option -k 1; 96.20% pairs aligned concordantly exactly 1 time) , and would like to use htseq-count to get count data across genes. I am having trouble retaining reads sorted after converting a sorted bam to sam format (htseq-count needs sorted sam for PE reads).

    These are my attempts and error messages:

    # sorting reads
    $ samtools sort myalignment.bam myalignment.sorted

    # convert back to sam
    $ samtools view -h myalignment.sorted.bam > out.sorted.sam

    # check (truncated output) - note @HD line 'unsorted', ?
    $ head out.sorted.sam
    @HD VN:1.0 SO:unsorted
    @SQ SN:NC_017656.1 LN:5212843
    @PG ID:bowtie2 PN:bowtie2 VN:2.0.0-beta7
    HWUSI-EAS1615L:13:FC64RB1AAXX:4:23:7604:14541_1 99 NC_017656.1 156 255 68M = 206 118 CAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCA IIIIIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIHIIIIHGIIIIGHIIHIHH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:68 YS:i:0 YT:Z:CP
    HWUSI-EAS1615L:13:FC64RB1AAXX:4:70:9040:11393_1 99 NC_017656.1 164 255 68M = 207 111 TAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATT IIIIFIIIIBHHHIFIIIIIIIIIHIGIHIIIIIFHIIIIBIHGHIGHIHHICIHCHF;FEDEFDEH< AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:68 YS:i:0 YT:Z:CP

    # tried htseq-count (truncated output)
    $ htseq-count -s no -t gene -i ID out.sorted.sam ../reference.gff
    4965 GFF lines processed.
    Warning: Read HWUSI-EAS1615L:13:FC64RB1AAXX:4:23:7604:14541_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
    Warning: Read HWUSI-EAS1615L:13:FC64RB1AAXX:4:70:9040:11393_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)
    Warning: Read HWUSI-EAS1615L:13:FC64RB1AAXX:4:62:8731:7335_1 claims to have an aligned mate which could not be found. (Is the SAM file properly sorted?)


    Your insight is much appreciated!

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-17-2024, 06:54 AM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
23 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-13-2024, 08:58 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
20 views
0 likes
Last Post seqadmin  
Working...
X