Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • xuguorong
    replied
    Thank you so much, dpryan!
    I fixed this issue after improving the unique mapping rate!

    Leave a comment:


  • dpryan
    replied
    Umm, well none of those reads uniquely aligned, so I'm not sure what else you would expect. Note the ZS, ZN, and NH flags, as well as the alignment scores.

    Leave a comment:


  • xuguorong
    replied
    Nobody knows how to run HTSeq with paired-end reads?

    Leave a comment:


  • xuguorong
    started a topic How to run HTSeq with paired end file

    How to run HTSeq with paired end file

    I have one paired end SAM file generated by Novoalign. The two ends of one pair share the same read ID, but the HTSeq reports all of them as "alignment_not_unique" and ignores them. Anybody know how to fix this issue? I used the following command,

    htseq-count --stranded=no --mode=intersection-nonempty -t exon -i gene_id inputFile.sam Homo_sapiens.GRCh37.67.chr.gtf > inputFile.htseq.count

    The following are 4 example reads.

    HWI-ST1189:59:C1305ACXX:5:1101:10000:108281 99 chrM 7910 3 51M = 8156 0 CGAGTACACCGACTACGGCGGACTAATCTTCAACTCCTACA
    TACTTCCCCC CCCFFFFFHHHHHJJJJJIJJJJIIJJIJJJJJJJIIHFHHHHFFFFFFED PG:Z:novoalignMPI NH:i:2 HI:i:1 AM:i:70 NM:i:0 SM:i:70 GN:Z:585 T
    N:Z:ENST00000361739 ZN:i:2 PQ:i:6 UQ:i:6 AS:i:6 ZS:Z:R
    HWI-ST1189:59:C1305ACXX:5:1101:10000:108281 147 chrM 8156 3 51M = 7910 0 GGTATACTACGGTCAATGCTCTGAAATCTGTGGAGCAAACC
    ACAGTTTCAT IJJJHIJJIJJJJIJJJJJJJJJJJIIJJJJJJJJIIIHHHHHFFFFFCCC PG:Z:novoalignMPI NH:i:2 HI:i:1 AM:i:70 NM:i:0 SM:i:70 GN:Z:585 T
    N:Z:ENST00000361739 ZN:i:2 PQ:i:6 UQ:i:0 AS:i:0 ZS:Z:R
    HWI-ST1189:59:C1305ACXX:5:1101:10000:12609 163 chr6 74229694 1 51M = 74229740 0 CCCGAATCTACGTGTCCAATGACGA
    CAATGTTGATATGAGTCTTTTCCTTT CCCFFFFFHHHHHIIJJJJIJJJJJJJJIJIIJJJJJJJJHIJJJJJIJJF PG:Z:novoalignMPI NH:i:3 HI:i:1 AM:i:70 NM:i:0 SM:i:70 G
    N:Z:1151 TN:Z:ENST00000309268 ZN:i:3 PQ:i:9 UQ:i:0 AS:i:0 ZS:Z:R
    HWI-ST1189:59:C1305ACXX:5:1101:10000:12609 83 chr6 74229740 1 40M943N11M = 74229694 0 CCTTTCCCATTTTGGCT
    TTTAGGGGTAGTTTTCACGACACCTGTGTTCTGG IJJJJJJJJJJJJJJJJJJJJJJJJJIJJJJJJIJIIHDHHHHFFFFFCCC PG:Z:novoalignMPI NH:i:3 HI:i:1 AM:i:70 NM:i:0 S
    M:i:70 GN:Z:1151 TN:Z:ENST00000309268 ZN:i:3 PQ:i:9 UQ:i:9 AS:i:9 ZS:Z:R XS:A:-

    Thanks in advance!
    Last edited by xuguorong; 10-26-2012, 04:15 PM.

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 07-16-2024, 05:49 AM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-15-2024, 06:53 AM
0 responses
28 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
40 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 09:45 AM
0 responses
205 views
0 likes
Last Post seqadmin  
Working...
X