Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • swbarnes2
    replied
    Originally posted by mathew View Post
    Thanks swbarnes2,

    I agree, so what I have done is I have aligned with just viral genome that is not very good (around 0.3% aligned reads). Then when I aligned to a combined human and viral genome it gives me around 70% aligned reads. However I am not sure how I can separate out the reads aligned to viral genome only.
    Samtools view is how you do that.

    Leave a comment:


  • Gators
    replied
    There are bowtie parameters to output only uniquely aligning reads.

    I think it is -m 1, the only output alignments are unique

    Leave a comment:


  • mathew
    replied
    Viral genome

    Thanks swbarnes2,

    I agree, so what I have done is I have aligned with just viral genome that is not very good (around 0.3% aligned reads). Then when I aligned to a combined human and viral genome it gives me around 70% aligned reads. However I am not sure how I can separate out the reads aligned to viral genome only. It may be that most of reads are mapped to human. As far as no of viral particles in that library are concerned the experiment has worked and mostly the induction is by viral infection which has translated well into human genome analysis. Any thought on how we can I get viral genome reads only? I have read papers which state that they just aligned to viral genome and then called peaks but it is not working in my case unless I am missing something.

    Thanks

    Leave a comment:


  • swbarnes2
    replied
    Ideally, if you know your samples has both human and viral sequence in it, you should be aligning to a reference that has both. That will give you the most accurate alignment.

    Would you expect the antibody to be binding to viral sequence?

    If you are getting very few reads aligning to virus, the simplest explanation is that you have very little virus in your library. Why have you dismissed that possibility?

    Leave a comment:


  • mathew
    replied
    Viral genome

    gsg Thanks I have sent a private message with my email. If you can share your script that will be a good start for me.

    Leave a comment:


  • gsgs
    replied
    well, I'm the new one since I don't know about the normal software and databases and companies etc.
    I write my own software, mainly just for influenza.

    After some years (!) I noticed, that for most comparisons we don't need
    alignment, we can just count the number of matching subsequences of certain length, no matter at what position they appear.

    I think this is also basically used in "blast", why it's so fast for big databases.

    So I wrote a program for that, (Windows 32-bit,cmd.exe commandline - DOS)
    but presumably there are other programs available for UNIX,Win64, etc,

    I can send my program, with source code or I run your data through it
    (all genbank viruses) it finds matching subsequences length 15-28

    (I speculate this is what you want, but am not sure)

    Leave a comment:


  • mathew
    replied
    viral genome seq

    Consider me a new in viral genome. Could you please explian how can I calculate sub seq ratio? Any pointer to URL or guidence will be great. I am using Bowtie aligner.

    Thanks

    Leave a comment:


  • gsgs
    replied
    I don't know your programs and acronyms, but what I woulf do is
    checking subsequences of length -say- 12. How many % of them are
    found, this is easy to check even for big databases. (all viruses
    from genbank or such)

    Leave a comment:


  • mathew
    started a topic viral genome alignment

    viral genome alignment

    I have a question, I am working on a chIPseq data where tumors are having a viral infection. We IP with a human specific antibody for our gene of interest. The S.E reads from hiseq were aligned to human genome using BWA which has worked fine and gave me some probable binding sites after peak calling. Now I am working on to find what happened to viral factors. So I took viral genome (around 10K) using Bowtie. Here is a screen shot for Bowtie SAM file, There are only 0.30% uniquely mapped reads.
    QNAME FLAG RNAME POS MAPQ CIGAR MRNM MPOS ISIZE SEQ QUAL OPT
    @HD VN:1.0 SO:unsorted
    @SQ SN:AF148805 LN:137969
    @PG ID:Bowtie VN:0.12.7 CL:"bowtie -q -p 8 -S -n 2 -e 70 -l 28 --maxbts 800 -y -k 1 -a --best --phred33-quals /tmp/3006527.cyberstar.psu.edu/tmp5nKzJC/tmpb50_zP /galaxy/main_pool/pool3/files/005/338/dataset_5338393.dat"
    HWI-ST550_0201:3:1101:1671:2197#ACAGTG/1 4 * 0 0 * * 0 0 AAAATTCAGGCTCTCTATTTCACAGTTCATTAGTTCATTCGTTTACTGTG CCCFFFFFHHHHHJGIJJJJHIIJJJIGIHIIIJJGIJJJJJJJIJIJII XM:i:0
    HWI-ST550_0201:3:1101:1678:2241#ACAGTG/1 4 * 0 0 * * 0 0 AGTGGTGTTTAATATAGTTTTGGGTATTTTTAACTAAAAATCATTGTTAT ?@@B?2AD?D<<CAE4AGHIF9CEG+AFDHID3C?9?CDFC**:?9*B9D XM:i:0
    HWI-ST550_0201:3:1101:1626:2216#ACAGTG/1 4 * 0 0 * * 0 0 GTTGCGGGAGAAGCCAAACGCGGCGAGTCTTGCTAAAGCCGTCGCCGTAG BBCFFFFFFHHHF>GGGHCGEHIGGAE=CDFACEEEEDDDBDD;BB57<? XM:i:0
    HWI-ST550_0201:3:1101:1580:2218#ACAGTG/1 4 * 0 0 * * 0 0 ACAGAAATGGCATCAAGAGACCTTGATTACAAGGATATGAATCTCTTAAG CCCFFFFFHHGHHIIJJIJJJJJJJDIJJJIIIJIJJJJIJJIJIJJIJI XM:i:0
    HWI-ST550_0201:3:1101:1779:2214#ACAGTG/1 4 * 0 0 * * 0 0 CCAATCTCTGCTACAGTTTGTTTCCCTCAATTTCTAATTACTTTAAAAAG CC@FFFFFHHDHDFGHEGIJIIJJJJGIGJJJJJIIJJEIIEHGJIGJJI XM:i:0

    _________________________________________________________

    How I should be selecting only uniquely mapped reads to viral genome?
    Why I have so low number of uniquely mapped reads? Is there any way that I can increase this unique mapping? What will be the best strategy to align to viral genome in this case, Should I be aligning to viral genome all reads or first align to human then align to un-mapped reads to viral genome. I also tried it with BWA gave around 0.29% unique alignment.

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 07:20 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-16-2024, 05:49 AM
0 responses
32 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-15-2024, 06:53 AM
0 responses
36 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
41 views
0 likes
Last Post seqadmin  
Working...
X