Right, I forgot to precise that GEM is exhaustive and reports *all* possible alignments within a maximum number of mismatches. There are indeed many other alignments for read1.
Still, I find it surprising that the primary alignment is transchromosomal (chrX-chr18) when a perfect match is found for a mate on the same chromosome. I should probably ask the authors.
Thanks for your answer kmcarr.
-
Read 1 has multiple alignments. The FLAG value for the read 1 alignment, 353, indicates that this reported alignment is not "primary" meaning there is at least one other alignment for read 1. The primary alignment for read 1 is at chr18:37526012.Originally posted by syfo View Post
How primary/secondary alignments are determined and reported is a function of the mapping program used. I am not familiar with GEM mapper so can't provide any insight there.Leave a comment:
-
Inconsistent pairing in SAM file?
In that SAM file, read1's mate is read2 but read2's mate is not read1. Is that possible? Both are on chrX, convergent orientation (-> <-), perfectly mapped (36M).
Am I missing something or something is wrong here? How can read2's mate be on chr18 while it could be read1?Code:HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 353 chrX 66951034 254 36M = 66957305 0 AAATGGCAAAAAGACAAAAATAAATAAATAAATAAA ?????BBBDDDBDDDDFFFFFFIIIIIIIIIHIIII RG:Z:0 NM:i:0 XT:A:R md:Z:36 HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 145 chrX 66957305 254 36M chr18 37526012 0 ACATGGTAACCTGTCTCATAGCAGGACTCTGGAATG ?????BBBDDDDDDDDFFFFFFCHIHHIIIIIFHII RG:Z:0 NM:i:1 XT:A:U md:Z:1T34
Reads from the two fastq files:
I used the GEM mapperCode:@HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 1:N:0:GTCCGCTTTATTTATTTATTTATTTTTGTCTTTTTGCCATTT @HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 2:N:0:GTCCGCCATTCCAGAGTCCTGCTATGAGACAGGTTACCATGT
What do you think, bug or feature?
Thanks
-
Innovations in next-generation sequencing technologies and techniques are driving more precise and comprehensive exploration of complex biological systems. Current advancements include improved accessibility for long-read sequencing and significant progress in single-cell and 3D genomics. This article explores some of the most impactful developments in the field over the past year.
Long-Read Sequencing
Long-read sequencing has seen remarkable advancements,...12-02-2024, 01:49 PM
Leave a comment: