Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • picard SamToFastq error in umapped reads which MAPQ is not 0

    Hi,
    SamToFastq.jar will be stop when it meet the unmapped reads which flag is 4 or 20 but the MAPQ is not 0. Picard is not so smart,it couldnot skip this reads but stop to deal next reads.
    I am also confused why unmapped reads MAPQ is not 0? I found many of unmapped reads which flag is 4 or 20 has MAPQ and OPT column. MAPQ 37 is the highest sore in bwa reasult and normal means its unique mapping reads.
    I use bwa Version: 0.6.1-r104 to do mapping.
    Can someone know how to deal these reads,I want to mapping unmaped reads to junction?


    Code:
    java -jar SamToFastq.jar INPUT=s_3_2_unmap_genome.sam FASTQ=s_3_2_unmap_genome.fq
    
    
    Wed Dec 05 09:27:59 HKT 2012] net.sf.picard.sam.SamToFastq done. Elapsed time: 1.19 minutes.
    Runtime.totalMemory()=262864896
    FAQ:  http://sourceforge.net/apps/mediawiki/picard/index.php?title=Main_Page
    Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. MAPQ should be 0 for unmapped read.; Line 3205583
    Line: HWUSI-EAS724_0039:3:34:15714:3092#0       20      9       124595110       37      80M     *       0       0       AGTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAA
    ATGCTTAGATGGATAATTGTATCCCATAAACACAAAGGTTTGG        hggh]hghhhghghhhhhghhhhhhhhhhhdhhhhhhhcfhhghhhhhhhchhhghhfdhhhghhhhhhgghhghhghhh        XT:A:U  NM:i:1  XN
    :i:1  X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0G79
            at net.sf.samtools.SAMTextReader.reportErrorParsingLine(SAMTextReader.java:230)
            at net.sf.samtools.SAMTextReader.access$500(SAMTextReader.java:40)
            at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:434)
            at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:278)
            at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:250)
            at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:641)
            at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:619)
            at net.sf.picard.sam.SamToFastq.doWork(SamToFastq.java:129)
            at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
            at net.sf.picard.sam.SamToFastq.main(SamToFastq.java:118)
    Last edited by upper; 12-05-2012, 05:33 PM.

  • #2
    Set the VALIDATION_STRINGENCY to LENIENT. Picard will still warn you about those reads, but it will go past them.

    bwa will throw the 4 flag if a read hangs off the edge of one of your references, but it will also give it a mapping position and MAPQ. That likely is the source of your problem reads.

    Comment


    • #3
      Originally posted by swbarnes2 View Post
      Set the VALIDATION_STRINGENCY to LENIENT. Picard will still warn you about those reads, but it will go past them.

      bwa will throw the 4 flag if a read hangs off the edge of one of your references, but it will also give it a mapping position and MAPQ. That likely is the source of your problem reads.
      thank you,picard ignore these reads and continue process,and also picard just report error as before but didnot remove these reads,this is what I want.

      Code:
      INPUT=s_3_2/s_3_2_unmap_genome.sam FASTQ=s_3_2/s_3_2_unmap_genome.fq VALIDATION_STRINGENCY=LENIENT
      
      Ignoring SAM validation error due to lenient parsing:
      Error parsing text SAM file. MAPQ should be 0 for unmapped read.; Line 3205583
      Line: HWUSI-EAS724_0039:3:34:15714:3092#0       20      9       124595110       37      80M     *       0       0       AGTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAA
      ATGCTTAGATGGATAATTGTATCCCATAAACACAAAGGTTTGG        hggh]hghhhghghhhhhghhhhhhhhhhhdhhhhhhhcfhhghhhhhhhchhhghhfdhhhghhhhhhgghhghhghhh        XT:A:U  NM:i:1  XN
      :i:1  X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0G79

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Essential Discoveries and Tools in Epitranscriptomics
        by seqadmin




        The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
        04-22-2024, 07:01 AM
      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Today, 08:47 AM
      0 responses
      10 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      60 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      57 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      53 views
      0 likes
      Last Post seqadmin  
      Working...
      X