RNASeq paired-end strand specific attribute location in FASTA file

[mknut]

According to TopHat documentation ( for --library-type option) if a strand-specific protocol was used in paired-end sequencing there should be an XS attribute tag assigned to every read. Right - I got my reads in FASTA format - where is my XS tag? If it's not there, where would it normally be? First four reads from raw FASTA file:

@A:3:1101:1441:2249#CTTGCAAC/1 CGCTGGGGCACAGTGACAGGAAACTGAGCAAAACAGCTCGTTGGCACTGATATGCCCCTCCCACCTCCCAGCTCCTGACTCCTATGGGCTGTTGGCTGCC 
+A:3:1101:1441:2249#CTTGCAAC/1 bbbeeeeegggggfghiiiihhhhghdghhhiiihiiidgghghiihhifggfhcegfhiggggeeeebdddbbcbbbcc]bR]b]acbccbYbc^ 
@A:3:1101:1593:2030#CTTGCAAC/1 NTGGAAGCAGCAGGTGGAATCCAAGAATATGCCCTTTCAGGATGGCCAAGAATTTGAACTGAGCATCTCAGTGCTGCCAGATAAGTACCAGGTAATGGTC 
+A:3:1101:1593:2030#CTTGCAAC/1 BP\c`acae^eegdffdeabgfdgddgff^egfghPI^cafhhhhZacfgfhghfghggbe_dghbfdgdgdgabZ^`bbbbbbabbbcbbb_

[maubp]

I'm assume the edit has messed up the line breaks (it looked OK via my RSS feed).

Next, you have a FASTQ file there, not a FASTA file.

Finally, I believe you are asking about using an XS tag which applies to a SAM/BAM file (not in FASTA or FASTQ files).

[mknut]

My bad, mixed up the files. Found it now. Thanks