Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • lakshmaa
    replied
    solexa2fastq.pl

    Hi All,

    I used solexa2fastq.pl on my Bustard directory and worked fine for the first time. ( there was same number of qhg,sig2,prb and seq text files in this directory).

    In another case, I noticed the prb,sig2 and qhg are many in number but there is only one seq.txt file. And this script does not run on folders like this.
    Any idea?

    Thanks

    Leave a comment:


  • Farhat
    replied
    Originally posted by lakshmaa View Post
    Hello All,

    I have prb file and I am trying to use this script on it. Right now I have a tar.gz file .
    When I try to untar it . It complains of error.
    Code:
    lakshmaa@hpcc01 Bustard_04NOV08_input_lane7]$ tar xzvf lane7_prb.tar.gz 
    
    gzip: stdin: not in gzip format
    tar: Child returned status 1
    tar: Error exit delayed from previous errors
    [lakshmaa@hpcc01 Bustard_04NOV08_input_lane7]$ ls
    lane7_prb.tar.gz  lane7_qhg.tar.gz  lane7_seq.txt  lane7_sig2.tar.gz
    I have no idea why this happens. Does anyone have any suggestions?

    Thanks
    As it says, your gzip file is not in gzip format. It likely got truncated during transfer. Download the file again and retry.

    Leave a comment:


  • lakshmaa
    replied
    Hello All,

    I have prb file and I am trying to use this script on it. Right now I have a tar.gz file .
    When I try to untar it . It complains of error.
    Code:
    lakshmaa@hpcc01 Bustard_04NOV08_input_lane7]$ tar xzvf lane7_prb.tar.gz 
    
    gzip: stdin: not in gzip format
    tar: Child returned status 1
    tar: Error exit delayed from previous errors
    [lakshmaa@hpcc01 Bustard_04NOV08_input_lane7]$ ls
    lane7_prb.tar.gz  lane7_qhg.tar.gz  lane7_seq.txt  lane7_sig2.tar.gz
    I have no idea why this happens. Does anyone have any suggestions?

    Thanks

    Leave a comment:


  • kmcarr
    replied
    Originally posted by husamia View Post
    So 78% of my total reads passed quality filtering for one strand.
    78% passing is a quite acceptable number
    Can we say this is a good measure for experiment success?
    No. The (default) Illumina quality filtering only considers the first 25 cycles of read 1. Even if the read quality goes completely off the rails after cycle 25, once the Illumina software calls it filter passed, it's passed. A program like FastQC can give you a better idea of the overall quality of your reads.

    Leave a comment:


  • husamia
    replied
    Originally posted by kmcarr View Post
    The export file contains information for all reads. The script only outputs filter passing reads; that is, those reads which have a "Y" in the last column of the export file. Filter passing is determined during the image analysis stage of the Illumina pipeline, before the base calling and alignment stage. There are no arguments you can pass to fq_all2std.pl which will cause it to output all reads (and you probably wouldn't want to anyway). If you want it to output all the read you would need to modify the script or roll your own.
    So 78% of my total reads passed quality filtering for one strand. Can we say this is a good measure for experiment success? regardless weather or not this is a good number, is it a good number?

    Leave a comment:


  • kmcarr
    replied
    Originally posted by husamia View Post
    You are right, I did export2std and I got converted FASTQ
    @HWI-EAS393_0031:5:12:13532:8891/1
    CTGCCAAGGAAGTCTCAAATTCAAGGAGAAGTTTCC
    +
    GFGGGGGGGEGGDGGGGGEFGFGGGCFGEGGEGFFG
    But export file contains 43,236,910 reads and my converted file contains only 33,742,681 reads. Is there quality filtering and what are the paramenters?
    By the way I used this script
    http://github.com/dandavison/msg/raw.../fq_all2std.pl
    The export file contains information for all reads. The script only outputs filter passing reads; that is, those reads which have a "Y" in the last column of the export file. Filter passing is determined during the image analysis stage of the Illumina pipeline, before the base calling and alignment stage. There are no arguments you can pass to fq_all2std.pl which will cause it to output all reads (and you probably wouldn't want to anyway). If you want it to output all the read you would need to modify the script or roll your own.

    Leave a comment:


  • husamia
    replied
    Originally posted by kmcarr View Post
    You used the command "scarf2std" but your input is an export file. You need to use this command instead.
    Code:
    perl fq_all2std.pl export2std s_5_1_export.txt
    You are right, I did export2std and I got converted FASTQ
    @HWI-EAS393_0031:5:12:13532:8891/1
    CTGCCAAGGAAGTCTCAAATTCAAGGAGAAGTTTCC
    +
    GFGGGGGGGEGGDGGGGGEFGFGGGCFGEGGEGFFG
    But export file contains 43,236,910 reads and my converted file contains only 33,742,681 reads. Is there quality filtering and what are the paramenters?
    By the way I used this script
    GitHub is where people build software. More than 100 million people use GitHub to discover, fork, and contribute to over 420 million projects.

    Leave a comment:


  • kmcarr
    replied
    Originally posted by husamia View Post
    I have not been able to convert using fq_all2std.pl
    ie. perl fq_all2std.pl scarf2std s_5_1_export.txt gives me
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in concatenation (.) or string at fq_all2std.pl line 69, <> line 1.
    @HWI-EAS393 0031 5 12 13532 8891 0 1 CTGCCAAGGAAGTCTCAAATTCAAGGAGAAGTTTCC fefffffffdffcfffffdefefffbefdffdfeef c20.fa 2553076 R 36 118 236 -107 F Y
    ____

    +
    Use of uninitialized value in split at fq_all2std.pl line 71, <> line 1.

    Is there anyway to convert this format to FASTQ?
    You used the command "scarf2std" but your input is an export file. You need to use this command instead.
    Code:
    perl fq_all2std.pl export2std s_5_1_export.txt
    Originally posted by kmcarr;
    As far as I can recall Illumina never combines the read pairs in a single file. Read 1 and read 2 are always reported in separate fastq or qseq files with appropriate names (e.g. s_1_1_sequence.txt for lane 1 read 1). Read pairs are associated by their read names, not by being in the same file.
    Originally posted by adamdeluca View Post
    There are alignment tools (like BFAST) that require paired ends to be interleaved.
    http://seqanswers.com/forums/showthread.php?t=3905
    True enough, but that does not change the fact that the Illumina software outputs separate files for reads 1 and 2. It is up to the user to merge the reads into a single file if required for downstream analysis.

    Leave a comment:


  • adamdeluca
    replied
    Originally posted by kmcarr View Post
    As far as I can recall Illumina never combines the read pairs in a single file. Read 1 and read 2 are always reported in separate fastq or qseq files with appropriate names (e.g. s_1_1_sequence.txt for lane 1 read 1). Read pairs are associated by their read names, not by being in the same file.
    There are alignment tools (like BFAST) that require paired ends to be interleaved.
    Discussion of next-gen sequencing related bioinformatics: resources, algorithms, open source efforts, etc

    Leave a comment:


  • husamia
    replied
    I have not been able to convert using fq_all2std.pl
    ie. perl fq_all2std.pl scarf2std s_5_1_export.txt gives me
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in join or string at fq_all2std.pl line 68, <> line 1.
    Use of uninitialized value in concatenation (.) or string at fq_all2std.pl line 69, <> line 1.
    @HWI-EAS999 0031 5 12 13532 8891 0 1 CTGCCAAGGAAGTCTCAAATTCAAGGAGAAGTTTCC fefffffffdffcfffffdefefffbefdffdfeef c20.fa 2553076 R 36 118 236 -107 F Y
    ____

    +
    Use of uninitialized value in split at fq_all2std.pl line 71, <> line 1.

    Is there anyway to convert this format to FASTQ?
    Last edited by husamia; 12-08-2010, 12:30 PM.

    Leave a comment:


  • MQ-BCBB
    replied
    kmcarr,

    I am very thankful for the script. It worked for me too!

    Leave a comment:


  • kmcarr
    replied
    Originally posted by baohua100 View Post
    How about paired-end reads?

    When I use fq_all2std.pl , it only output single-end
    What is input file are you using? As far as I can recall Illumina never combines the read pairs in a single file. Read 1 and read 2 are always reported in separate fastq or qseq files with appropriate names (e.g. s_1_1_sequence.txt for lane 1 read 1). Read pairs are associated by their read names, not by being in the same file.

    Leave a comment:


  • baohua100
    replied
    How about paired-end reads?

    When I use fq_all2std.pl , it only output single-end

    Leave a comment:


  • Oxygen81
    replied
    Originally posted by kmcarr View Post
    When the sript is done there will be a file named foo.fastq which you can use as input for MAQ.
    Dear kmcarr,

    thank you very much for your help! I tested your script and everything is working fine! :-)

    Originally posted by SWBARNES2 View Post
    That might work.
    Dear swarbarnes2,

    thanks to you, too. I will try your solution tomorrow. I have seen it to late.
    Last edited by Oxygen81; 08-10-2009, 08:02 AM.

    Leave a comment:


  • kmcarr
    replied
    Originally posted by Oxygen81 View Post
    Hello everybody,

    like some others here I have some problems to convert my Solexa reads into an appropriate format for Maq.
    I tried the scipts fq_all2std.pl and the Script of Farhad (#7) but nothing is working. Here is an example of my files:
    *.seq.txt
    >KN-964_02-2424_07-03179_1_1_1_1001_230
    GTGCTAA ... (36 sites)

    *.qual.txt
    >KN-964_02-2424_07-03179_1_1_1_1001_230
    32 32 32 32 32 32 32 ...

    The sequencing was done in 2007. The command seqprb2std is not contained in fq_all2std.pl, is it? We did an other sequencing (paired-end) in 2008/2009 where I got a new format:
    >KN-1413_07-00010:6:1:727:174/1: GTGTG...:40 40 40 40 40
    These files are in standard FASTA format, with separate sequence and qualtiy score files. Here is a perl script which will take these two files as input an output a standard Sanger FASTQ file which can be used with MAQ.
    Code:
    #!/usr/bin/perl
    
    use warnings;
    use strict;
    use File::Basename;
    
    my $inFasta = $ARGV[0];
    my $baseName = basename($inFasta, qw/.fasta .fna/);
    my $inQual = $baseName . ".qual";
    my $outFastq = $baseName . ".fastq";
    
    my %seqs;
    
    $/ = ">";
    
    open (FASTA, "<$inFasta");
    my $junk = (<FASTA>);
    
    while (my $frecord = <FASTA>) {
            chomp $frecord;
            my ($fdef, @seqLines) = split /\n/, $frecord;
            my $seq = join '', @seqLines;
            $seqs{$fdef} = $seq;
    }
    
    close FASTA;
    
    open (QUAL, "<$inQual");
    $junk = <QUAL>;
    open (FASTQ, ">$outFastq");
    
    while (my $qrecord = <QUAL>) {
            chomp $qrecord;
            my ($qdef, @qualLines) = split /\n/, $qrecord;
            my $qualString = join ' ', @qualLines;
            my @quals = split / /, $qualString;
            print FASTQ "@","$qdef\n";
            print FASTQ "$seqs{$qdef}\n";
            print FASTQ "+\n";
            foreach my $qual (@quals) {
                    print FASTQ chr($qual + 33);
            }
            print FASTQ "\n";
    }
    
    close QUAL;
    close FASTQ;
    Some notes about this script.

    - It expects the filenames to be in the form foo.fasta (or foo.fna) and foo.qual so you would need to rename your *.seq.txt and *.qual.txt to match this format (or edit the code).

    - The sequence and quality score entries in the file do NOT need to be in the same order in their respective files but the definition lines between the two must match exactly. The sacrifice for this is RAM, it stores all of the sequences in a hash and then writes them out as it is looping through the qual file.

    To use the script save the text as fastaQual2Fastq.pl and make it executable. Make sure that both your .fasta and .qual file are named as described above and in your current directory then run the script:

    Code:
    % fastaQual2Fastq.pl foo.fasta
    When the sript is done there will be a file named foo.fastq which you can use as input for MAQ.
    Last edited by kmcarr; 08-07-2009, 08:41 AM.

    Leave a comment:

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-21-2024, 07:49 AM
0 responses
15 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-20-2024, 07:23 AM
0 responses
15 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-17-2024, 06:54 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
27 views
0 likes
Last Post seqadmin  
Working...
X