Originally posted by hard998
View Post
-
These are called repeats. You probably have more than 2 contigs with this sequence on one end. Therefore, Velvet did not merge them because that would cause an assembly error, which produce chimeric contigs. -
contig overlaps in velvet 1.2.03
Hi, I did a denovo assembly using velvet 1.2.03 which gave me 1626 contigs,
However, when I examined the contig.fa output by velvet, eg
>NODE_1331_length_2655_cov_63.920151
>NODE_1395_length_1978_cov_42.813953
...
I found 689 contigs have tail-to-tail matches with each other by doing BLAST, such as
NODE_1331_length_2655_cov_63.920151: 2656 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 2699
||||||||||||||||||||||||||||||||||||||||||||
NODE_1395_length_1978_cov_42.813953: 2022 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 1979
Can anyone tell me why didn't velvet merge those overlaps? Is that correct for me to join contigs into larger contigs? Thank you!
-
Metagenomics has improved the way researchers study microorganisms across diverse environments. Historically, studying microorganisms relied on culturing them in the lab, a method that limits the investigation of many species since most are unculturable1. Metagenomics overcomes these issues by allowing the study of microorganisms regardless of their ability to be cultured or the environments they inhabit. Over time, the field has evolved, especially with the advent...09-23-2024, 06:35 AM -
During the COVID-19 pandemic, scientists observed that while some individuals experienced severe illness when infected with SARS-CoV-2, others were barely affected. These disparities left researchers and clinicians wondering what causes the wide variations in response to viral infections and what role genetics plays.
Jean-Laurent Casanova, M.D., Ph.D., Professor at Rockefeller University, is a leading expert in this crossover between genetics and infectious...09-09-2024, 10:59 AM
Leave a comment: