Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • contig overlaps in velvet 1.2.03

    Hi, I did a denovo assembly using velvet 1.2.03 which gave me 1626 contigs,

    However, when I examined the contig.fa output by velvet, eg
    >NODE_1331_length_2655_cov_63.920151
    >NODE_1395_length_1978_cov_42.813953
    ...

    I found 689 contigs have tail-to-tail matches with each other by doing BLAST, such as
    NODE_1331_length_2655_cov_63.920151: 2656 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 2699
    ||||||||||||||||||||||||||||||||||||||||||||
    NODE_1395_length_1978_cov_42.813953: 2022 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 1979


    Can anyone tell me why didn't velvet merge those overlaps? Is that correct for me to join contigs into larger contigs? Thank you!

  • #2
    Originally posted by hard998 View Post
    Hi, I did a denovo assembly using velvet 1.2.03 which gave me 1626 contigs,

    However, when I examined the contig.fa output by velvet, eg
    >NODE_1331_length_2655_cov_63.920151
    >NODE_1395_length_1978_cov_42.813953
    ...

    I found 689 contigs have tail-to-tail matches with each other by doing BLAST, such as
    NODE_1331_length_2655_cov_63.920151: 2656 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 2699
    ||||||||||||||||||||||||||||||||||||||||||||
    NODE_1395_length_1978_cov_42.813953: 2022 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 1979


    Can anyone tell me why didn't velvet merge those overlaps? Is that correct for me to join contigs into larger contigs? Thank you!
    These are called repeats. You probably have more than 2 contigs with this sequence on one end. Therefore, Velvet did not merge them because that would cause an assembly error, which produce chimeric contigs.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Exploring the Dynamics of the Tumor Microenvironment
      by seqadmin




      The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
      07-08-2024, 03:19 PM
    • seqadmin
      Exploring Human Diversity Through Large-Scale Omics
      by seqadmin


      In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
      06-25-2024, 06:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 07-10-2024, 07:30 AM
    0 responses
    29 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-03-2024, 09:45 AM
    0 responses
    201 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-03-2024, 08:54 AM
    0 responses
    212 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-02-2024, 03:00 PM
    0 responses
    193 views
    0 likes
    Last Post seqadmin  
    Working...
    X