Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problems with displaying reads in SAM format in IGV - Integrative Genome Viewer

    Hi!
    I have my doubts about the IGV displaying reads in sam-format correctly.

    The reads in sam-format all have the same length (90) but appear like being of different lengths when I upload them in IGV. The same happend with the same file in BAM format.
    I converted the SAM-file to a BED-file using Pyicos. Uploading this BED-file results into a correct display of the reads. See uploaded SAM-file (upper track) and uploaded BED-file (lower track) in attachment.
    But when BED is displayed, I can obviously not see the actual sequences of the reads (to look for polymorphisms).

    I am using the latest version of IGV: IGV_2.2.5

    Did anyone see this issue as well and knows a way around it?

    Below I give the SAM-file and the BED-file, as well as the command for the conversion.
    Any help is highly appreciated!
    Thanks!
    Sonja






    # here the command to convert sam to bed:
    pyicos convert input.sam output.bed -f sam -F bed

    # here the SAM-file
    ERR045703.5732207 99 19 16149684 60 75M15S = 16150110 508 AACGGGCACCCAGTGAGCACTCGAGGATGACCCTCCTCGGGCAGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGA B5@9FGGIFHHIIEFAFFHHKI@IKJIHG@EJJKIJKI?GGB>CGBHGJ@HEABAD?B@DCDC898?>GCGGBH################ X0:i:1 X1:i:0 XC:i:75 MD:Z:75 RG:Z:ERR045703 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    ERR045704.58587335 163 19 16149690 60 37M53S = 16150123 494 CACCCAGGGAGCACTCGAGGATGACCCTCCTCGGGCAGCTGCCGCCCACCCTGTAGCGACTGTCCCCAAGTGAGCAGGGAGGGAAGCGAG @EC3<B=',EF/GBFE:7E<C->*416@A@8B;+$@###################################################### X0:i:1 X1:i:0 XC:i:37 MD:Z:7T29 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    ERR045703.17024081 147 19 16149699 60 8S82M = 16149269 -511 ACCCAGTGAGCACTCGAGGATGACCCTCCTCGGGCAGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGC #########A=??=AFGD>?@37E=?9=:=4@@BBC=:=DA?CGADADGJKHJKJAFJJJFBGJGCGHEKIJIIGHHAHGGFGHDGCFC@ X0:i:1 X1:i:0 XC:i:82 MD:Z:82 RG:Z:ERR045703 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    ERR045704.7021863 147 19 16149705 60 7S83M = 16149294 -493 GACCACTCGAGGATGCCCCTCCTCGGGCAGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCAC ########EEHGE?E?D<EFD>EEFDGEDFE?<BF?BFGIJKEIGG>IJJIGFHKHHFKHLJKJJIIIIJGIIJJHGGHGGDGCFEH@ X0:i:1 X1:i:0 XC:i:83 MD:Z:8A74 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    ERR045704.32772245 163 19 16149726 60 90M = 16150187 499 AGCTGCCGCCCACCCAGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCAGCCGT @EDFFFG?GEHIFGHIJHHIH@FFKJIHJJJJLIEFIKJKJKI?FHHJIFJEGEEGFCECHB=EEDFEFHFHHGFIH,:CGIHH>@EC<F X0:i:1 X1:i:0 MD:Z:90 RG:Z:ERR045704 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@A
    ERR045704.57426661 163 19 16149741 60 90M = 16150165 492 AGTAGCGACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCAGCCGTGCAGAGATGTGCCTC @EFEFF>HFHHGHGHIJ@GGGIIJJKKJGIBB??CHEJFFJHG@@DC>HIEGIJFC@FDCGFFHEIBFFGFGG=BBAEDJHHGIH;C?HD X0:i:1 X1:i:0 MD:Z:90 RG:Z:ERR045704 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@BB
    ERR045703.16563758 83 19 16149748 60 90M = 16149339 -498 ACTGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCAGCCGTGCAGAGATGTGCCTCTCACCTA EAGDDFGEHBIFIGHHGIGGEJDIEHIHIHIDHKJHHHHAKHJKJKKJKKELKJIHJJKKGJIJJAHHAJKIJIJIGIH@HIHGCCACB6 X0:i:1 X1:i:0 MD:Z:90 RG:Z:ERR045703 AM:i:37 NM:i:0 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    ERR045704.56912904 147 19 16149756 60 13S77M = 16149309 -523 TAGCGACCGTCCCCAAGTCAGCAGCGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCAGCCGTGCAGAGATGTGCCTCTC ##############AIEEFI>>43)<H@8FA9-GA02BD:46?E7ED<.6,.>1.=ECC,97E4C8ECA2'2-'EG<9,,;BHG=?GGD; X0:i:1 X1:i:0 XC:i:77 MD:Z:11G65 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@
    ERR045704.58477016 147 19 16149772 60 37S53M = 16149322 -502 CCACCCCGCAGCGACGGTCCCCAAGTCAGCAGGGAGGGAAGAGAGCAGGTCACGCTCTCCTAAGTCTGATCAAGCGGCCGTGCAGAGATG ######################################?F@?4DD9@IDG=5';GEC=(7C4HB8GHCIF<(C=&%%$4*[email protected]/ X0:i:1 X1:i:0 XC:i:53 MD:Z:38A14 RG:Z:ERR045704 AM:i:37 NM:i:1 SM:i:37 MQ:i:60 XT:A:U BQ:Z:@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@




    # here is the BED-file
    19 16149684 16149773 ERR045703.5732207 0 +
    19 16149690 16149779 ERR045704.58587335 0 +
    19 16149699 16149788 ERR045703.17024081 0 -
    19 16149705 16149794 ERR045704.7021863 0 -
    19 16149726 16149815 ERR045704.32772245 0 +
    19 16149741 16149830 ERR045704.57426661 0 +
    19 16149748 16149837 ERR045703.16563758 0 -
    19 16149756 16149845 ERR045704.56912904 0 -
    19 16149772 16149861 ERR045704.58477016 0 -
    Attached Files

  • #2
    It looks like IGV is just not showing the soft-clipped regions. That would be the appropriate behaviour.

    Comment


    • #3
      soft-clip

      Thanks for your answer!
      what are soft-clipped regions, please?

      Comment


      • #4
        Can't find your 'S" ? 'S' operator documentation is here
        ...
        See CIGAR 'S' (soft clip) operation in sam/bam format documentation at sourceforge : http://samtools.sourceforge.net/SAM1.pdf

        As far as that recently added operator, don't 'X' me.

        Comment


        • #5
          does it basically mean that the base quality is very low in these regions?

          Comment


          • #6
            Originally posted by sonja View Post
            does it basically mean that the base quality is very low in these regions?
            In the case of your reads, at least, yes. You can see that from the quality scores (often #).

            Comment


            • #7
              yes, that´s exactly what I see!
              Thanks a lot!!!

              Comment


              • #8
                You can optionally display the soft-clipped reads, its a user preference (View > Preferences > Alignments tab).

                Comment


                • #9
                  great! I was looking for that... Thanks!!!

                  Comment

                  Latest Articles

                  Collapse

                  • seqadmin
                    Best Practices for Single-Cell Sequencing Analysis
                    by seqadmin



                    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                    06-06-2024, 07:15 AM
                  • seqadmin
                    Latest Developments in Precision Medicine
                    by seqadmin



                    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                    Somatic Genomics
                    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                    05-24-2024, 01:16 PM

                  ad_right_rmr

                  Collapse

                  News

                  Collapse

                  Topics Statistics Last Post
                  Started by seqadmin, 06-17-2024, 06:54 AM
                  0 responses
                  10 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 06-14-2024, 07:24 AM
                  0 responses
                  20 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 06-13-2024, 08:58 AM
                  0 responses
                  17 views
                  0 likes
                  Last Post seqadmin  
                  Started by seqadmin, 06-12-2024, 02:20 PM
                  0 responses
                  20 views
                  0 likes
                  Last Post seqadmin  
                  Working...
                  X