Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • #16
    Hi everyone,

    I have the same problem as below:
    Code:
    SEA055486C:139:C06FAACXX:6:2207:3530:3130       83      chrVII  675196  60      59M42S  =       675159  -96     TTGTTCGTGATGCTTCCGAAATTCCCGAAGGTTGCGTATTGCAATCTGTTAACCCAGAATCAGCCAGAACAAGAAGGACAAAGTGATCAAGACATAGGGAA  C>59<DCCDCDDDDB?CCCCCAB9,.HHHJJJIGIJIJIIJIGGE@FGIGHDEGEHFHGEGCG<EHDHHIIJIIHEHDGHHHGGGIGGFHHHFFDDFDCC@   NM:i:1  AS:i:54 XS:i:0  XP:Z:chrXVI,-908080,52S49M,60,0;
    [COLOR="Red"]SEA055486C:139:C06FAACXX:6:2207:3530:3130       83      chrXVI  908080  60      52S49M  chrVII  675159  0       TTGTTCGTGATGCTTCCGAAATTCCCGAAGGTTGCGTATTGCAATCTGTTAACCCAGAATCAGCCAGAACAAGAAGGACAAAGTGATCAAGACATAGGGAA  C>59<DCCDCDDDDB?CCCCCAB9,.HHHJJJIGIJIJIIJIGGE@FGIGHDEGEHFHGEGCG<EHDHHIIJIIHEHDGHHHGGGIGGFHHHFFDDFDCC@   NM:i:0  AS:i:49 XS:i:0  XP:Z:chrVII,-675196,59M42S,60,1;[/COLOR]
    SEA055486C:139:C06FAACXX:6:2207:3530:3130       163     chrVII  675159  60      96M5S   =       675196  96      ATTGTCTCGTTGATCAAGGCCATCGACGAAGTCACTGTTGTTCGTGATGCTTCCGAAATTCCAGAAGGTTGCGTATTGCAATCTGTTAACCCAGAATCAGC  B@@DBDDFHBFHDGIGGIIGHGGDCGIGEHH?BGHICGGHIIGI?FEGGEFA@FGGGEHHHGHEDEFF>AE@BB?BDDDDDDDD@DDCE>CBBDBDA@CCD   NM:i:0  AS:i:96 XS:i:0
    The read marked in red was aligned on different chromosomes. I have no idea what's happened to this case. Is it caused by the split algorithm?

    Thanks.

    Comment


    • #17
      I had the same error when I use an older version of picard (1.45). After downloading the newest picard (1.129) I no longer have the issue. Even without the -M option while mapping with bwa mem

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Advanced Tools Transforming the Field of Cytogenomics
        by seqadmin


        At the intersection of cytogenetics and genomics lies the exciting field of cytogenomics. It focuses on studying chromosomes at a molecular scale, involving techniques that analyze either the whole genome or particular DNA sequences to examine variations in structure and behavior at the chromosomal or subchromosomal level. By integrating cytogenetic techniques with genomic analysis, researchers can effectively investigate chromosomal abnormalities related to diseases, particularly...
        09-26-2023, 06:26 AM
      • seqadmin
        How RNA-Seq is Transforming Cancer Studies
        by seqadmin



        Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...
        09-07-2023, 11:15 PM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Yesterday, 09:38 AM
      0 responses
      9 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 09-27-2023, 06:57 AM
      0 responses
      11 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 09-26-2023, 07:53 AM
      1 response
      23 views
      0 likes
      Last Post seed_phrase_metal_storage  
      Started by seqadmin, 09-25-2023, 07:42 AM
      0 responses
      17 views
      0 likes
      Last Post seqadmin  
      Working...
      X