Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Recommendations for aligning short fragments from illumina PE

    Hello,

    I've recently performed Illumina PE (2x75) sequencing of enzymatically-fragmented genomic DNA, where the fragments going into the library prep ranged from 20 to 400 bp. I would like to align these reads to a reference genome to obtain locations and insert sizes, while discarding all reads that are not paired.

    Based on this workflow, we assume (to use bowtie2 manual terminology and diagrams) that:

    1) Mates may 'overlap' each other

    Code:
    Mate 1:    GCAGATTATATGAGTCAGCTACGATATTGTT
    Mate 2:                               TGTTTGGGGTGACACATTACGCGTCTTTGAC
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
    2) Mates may 'contain' each other

    Code:
    Mate 1:    GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC
    Mate 2:                               TGTTTGGGGTGACACATTACGC
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
    
    
    Mate 1:                   CAGCTACGATATTGTTTGGGGTGACACATTACGC
    Mate 2:                      CTACGATATTGTTTGGGGTGAC
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
    3) Mates may 'dovetail' each other

    Code:
    Mate 1:                 GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
    Mate 2:            TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT                   
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC
    I would like to find alignments and accurate insert sizes, even for the 20-bp fragments which may be classified in one of the above situations.

    After clipping 3' adapters and low-quality ends, and filtering reads of low quality, I've attempted to align these reads with bowtie2:

    Code:
    bowtie2 --dovetail --no-mixed --nodiscordant --no-unal -x reference -1 mates1.fastq -2 mates2.fastq -S aligned.sam
    The resulting sam contains only paired alignments with 'insert sizes' of the 20+ bp fragments I am interested in, but also a very large population of 'inserts sizes' the same size as the length of the reads themselves (75 bp). Importantly, there was not a large population of ~75 bp molecules that went into the library prep.

    It seems that this population of ~75-bp insert sizes is an alignment artifact. What can I do to test or resolve this? I cannot find another alignment program that explicitly states they can handle mates that dovetail or contain each other.

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    Yesterday, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 07:15 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
15 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
9 views
0 likes
Last Post seqadmin  
Working...
X