Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bwa mem segfault; bwa bwasw breaks MarkDuplicates

    Hi,
    I have run into various problems with various versions of bwa
    1. bwa mem gives a segmentation fault right away. Not sure how to debug that, no matter what memory (we have 48G) and thread settings. Has anyone else run into this problem?
    The call to bwa is
    bwa-0.7.5a/bwa mem -M -R "@RG\tID:$ID\tLIB:SeqCapEZ.v3\tID:$ID\tPL:ILLUMINA" -t 24 ucsc.hg19.fasta $READS1 $READS2 > $ALN_OUT.sam

    2. bwasw produces a file which does no work with MarkDuplicates.
    The call to bwa is
    /old_home/enabieva/bwa-0.7.5a/bwa mem -M -R "@RG\tID:$ID\tLIB:SeqCapEZ.v3\tID:$ID\tPL:ILLUMINA" -t 24 ucsc.hg19.fasta $READS1 $READS2 > $ALN_OUT.sam

    The MarkDuplicates error is:
    Exception in thread "main" net.sf.picard.PicardException: Value was put into PairInfoMap more than once. 1: null:HWI-ST992:135:C0YGDACXX:2:1108:12651:98485

    Grepping for that read brings up the following:
    HWI-ST992:135:C0YGDACXX:2:1108:12651:98485 113 chr1 564775
    0 43S47M chr2 55113029 0TATCGTC
    ACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAGAAATATG
    @DDDDEDBDDDDCCDFFFFFEGHHHGHIIGII
    HJIIGGFGAGEGGBJIIGHFBJJGEHHJGGGCIIIJJJIGGIIHHHFFHHFDFDD@@@
    AS:i:47 XS:i:47 XF:i:1 XE:i:1 NM:i:0
    HWI-ST992:135:C0YGDACXX:2:1108:12651:98485 113 chr1 566621
    0 51M39S chr2 55113029 0TATCGTC
    ACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATTACAATCTCCAGCATTCCCCCTCAAACCTAAGAAATATG
    @DDDDEDBDDDDCCDFFFFFEGHHHGHIIGII
    HJIIGGFGAGEGGBJIIGHFBJJGEHHJGGGCIIIJJJIGGIIHHHFFHHFDFDD@@@
    AS:i:51 XS:i:51 XF:i:1 XE:i:1 NM:i:0
    HWI-ST992:135:C0YGDACXX:2:1108:12651:98485 145 chr2
    55113029 168 90M * 0 0TGAGCCA
    CCACGTCCAGCCCACTTTTTGATTTTCAAAGAGTCAGAGCCCCAAAATTCCATCTCTTCCTTGCCTCTCATCGTAGGGTTCAC
    A:<?@<,8<=DBA@@?==3;;BBFEE>HEEEH
    CAHG@HFFEEEE<GIGIIGHGJJIHF>BIIEIIHGJIIIGGCFD?HDGGGFDDFF@@@
    AS:i:90 XS:i:0 XF:i:3 XE:i:2 NM:i:0

    So it seems that the problem is that the first read is mapped twice, but this is not marked in any way.

    I found a discussion of this problem, but the suggested solution seems roundabout.
    Does anyone else encounter this?

    Thanks,
    Elena
    Last edited by ElenaN; 06-13-2013, 03:24 AM. Reason: bad hyperlink format

  • #2
    Yes, I met exactly the same error with you. Although I used the -M option, it seems also not compatible well with picard. I'm looking forward to an effective solutions.
    Last edited by Zengquan; 06-29-2013, 09:44 PM.

    Comment


    • #3
      As far as I know the picard people are working with the bwa people to get the two programs to be more compatible. BWA MEM 0.7.4 should still work. The -M option is going to be gone and instead they are going to use a new flag which will have to be picked up by samtools and picard - but like I said they are all working together on this. I can't explain the seg-fault but I do know that the latest version of MEM has done away with what the -M option used to do. If you back up to a previous version of MEM it should still work. I'm using '0.7.4-r389-beta' and it mostly works. The bwa aln/sampe pipeline is broken in that it fails to properly annotate the 'XA' field of the alignments which triggers a bug in samtools if you attempt to run those alignments through it. However, that version's 'MEM' works perfectly for me (on Mac and Linux).
      /* Shawn Driscoll, Gene Expression Laboratory, Pfaff
      Salk Institute for Biological Studies, La Jolla, CA, USA */

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Exploring the Dynamics of the Tumor Microenvironment
        by seqadmin




        The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
        07-08-2024, 03:19 PM
      • seqadmin
        Exploring Human Diversity Through Large-Scale Omics
        by seqadmin


        In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
        06-25-2024, 06:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 07-19-2024, 07:20 AM
      0 responses
      40 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-16-2024, 05:49 AM
      0 responses
      52 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-15-2024, 06:53 AM
      0 responses
      64 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-10-2024, 07:30 AM
      0 responses
      43 views
      0 likes
      Last Post seqadmin  
      Working...
      X