Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • twoBitToFa usage

    Hi, I am having problem with using twoBitToFa -seqList=file command

    I tried with start=X, end=X. and these are working properly but I used my command as

    twoBitToFa -seqList=chr1:28735-29810 hg19.2bit hg.fa
    Couldn't open chr1:28735-29810 , No such file or directory

    and also tried
    twoBitToFa -seqList=chr1 hg19.2bit hg.fa
    Couldn't open chr1 , No such file or directory

    can any one please hel me to sort this problem?
    Thanks in advance

  • #2
    Code:
    -seqList=file
    looks for a file that has those parameters, you don't put them there directly.

    Code:
    [m@k4 hg19]$ ./twoBitToFa hg19.2bit:chr1:28735-29810 test.fa
    [m@k4 hg19]$ head test.fa
    >chr1:28735-29810
    CGCCTCTTTGGGACCGCGGTTTATACTTTCGAAGTGCTCGGAGCCCTTCC
    TCCAGACCGTTCTCCCACACCCCGCTCCAGGGTCTCTCCCGGAGTTACAA
    GCCTCGCTGTAGGCCCCGGGAACCCAACGCGGTGTCAGAGAAGTGGGGTC
    CCCTACGAGGGACCAGGAGCTCCGGGCGGGCAGCAGCTGCGGAAGAGCCG
    CGCGAGGCTTCCCAGAACCCGGCAGGGGCGGGAAGACGCAGGAGTGGGGA
    GGCGGAACCGGGACCCCGCAGAGCCCGGGTCCCTGCGCCCCACAAGCCTT
    GGCTTCCCTGCTAGGGCCGGGCAAGGCCGGGTGCAGGGCGCGGCTCCAGG
    GAGGAAGCTCCGGGGCGAGCCCAAGACGCCTCCCGGGCGGTCGGGGCCCA
    GCGGCGGCGTTCGCAGTGGAGCCGGGCACCGGGCAGCGGCCGCGGAACAC
    Hope that helps!

    Comment


    • #3
      Thank you, It really helped me

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Exploring the Dynamics of the Tumor Microenvironment
        by seqadmin




        The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
        07-08-2024, 03:19 PM
      • seqadmin
        Exploring Human Diversity Through Large-Scale Omics
        by seqadmin


        In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
        06-25-2024, 06:43 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, Yesterday, 06:53 AM
      0 responses
      12 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-10-2024, 07:30 AM
      0 responses
      34 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-03-2024, 09:45 AM
      0 responses
      204 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 07-03-2024, 08:54 AM
      0 responses
      213 views
      0 likes
      Last Post seqadmin  
      Working...
      X