Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • garethboy
    replied
    Thank you everybody. I have done my task. =)

    Leave a comment:


  • Kennels
    replied
    try this

    Code:
    paste - - < input.fa | awk ' { print $1"_"NR"\n"$2 } ' > output.fa
    make sure to have spaces between the hyphens for 'paste'

    Leave a comment:


  • atcghelix
    replied
    This work? (It assumes all sequence strings are on a single line)

    Code:
    awk '{if($0 ~ /^>/){print $0"_"(NR+1)/2}else{print $0}}' input.fasta > changed.fasta
    Last edited by atcghelix; 09-26-2013, 11:33 PM. Reason: Less confusing regex

    Leave a comment:


  • garethboy
    replied
    Running is UNIX

    Leave a comment:


  • atcghelix
    replied
    What version of Awk are you running/what operating system?

    Leave a comment:


  • garethboy
    replied
    Thanks. I am pretty weak in Perl. Do you have any idea using AWK to do this?

    Leave a comment:


  • garethboy
    replied
    Anyone know how to use AWK to do this task?

    Leave a comment:


  • Jeremy
    replied
    Heres another way: R

    Code:
    library(seqinr)
    read.fasta("fastafile.fa")->fa
    write.fasta(fa,names=paste(getName(fa),1:5,sep="_"),file.out="fa_new_name.fa")
    where you swap '1:5' with '1:n', n being the number of sequences you have.

    Leave a comment:


  • atcghelix
    replied
    Here's one way using Perl. Save the text in a file named numbers.pl (or whatever). Usage would be:

    perl numbers.pl --in file_to_change.fasta --out revised_file.fasta


    Code:
    #!/usr/bin/perl
    
    use strict;
    use warnings;
    use Getopt::Long;
    
    my $inFile;
    my $outFile;
    
    GetOptions  ("in=s"      => \$inFile,
                 "out=s"      => \$outFile);
    
    if (!$inFile or !$outFile) {
        die "Must supply both infile and outfile as command line arguments.\n";
    }
    
    open(my $inFH, "<", $inFile) or die "couldn't open infile for reading.\n";
    if (-e $outFile) {
        die "Output file $outFile already exists--aborting so you don't overwrite.\n";
    }
    open(my $outFH, ">", $outFile) or die "couldn't open outfile for writing.\n";
        
    my $counter = 1;
    while (my $line = <$inFH>) {
        chomp $line;
        if ($line =~ /^(>.*)/) {
            print $outFH $1 . "_$counter\n";
            $counter++;
        } else {
            print $outFH "$line\n";
        }
    }
    Last edited by atcghelix; 09-26-2013, 09:57 PM. Reason: Edited to move $counter++ so that you didn't just get odd-numbered sequences

    Leave a comment:


  • problem with adding numerical sequence at the end of line

    Hi,

    Anyone has any idea how to get this:

    >no_name
    TATGCATCGATGCACATATGCTAGTGCGCTAGTGTCGAGGCTAGCTACG
    >no_name
    GACGTACGTAGCATGCATGCATGCGTAGCTGTAGCTAGC
    >no_name
    GCTAGCTAGGTAGGTCATGTAGTAGGTGCACTGAGCTAGCTAGCTAGCTAGCAGC
    >no_name
    GCTAGCATGCTAGCTAGCTAGCACTAGCTAGCTAGCTAGCTAATGCATCATC
    >no_name
    GCTACGTAGCATGCTAGCGGATCATGCATGCATGCTAGCATCGATGCTAGCATGCAT

    become this:

    >no_name_1
    TATGCATCGATGCACATATGCTAGTGCGCTAGTGTCGAGGCTAGCTACG
    >no_name_2
    GACGTACGTAGCATGCATGCATGCGTAGCTGTAGCTAGC
    >no_name_3
    GCTAGCTAGGTAGGTCATGTAGTAGGTGCACTGAGCTAGCTAGCTAGCTAGCAGC
    >no_name_4
    GCTAGCATGCTAGCTAGCTAGCACTAGCTAGCTAGCTAGCTAATGCATCATC
    >no_name_5
    GCTACGTAGCATGCTAGCGGATCATGCATGCATGCTAGCATCGATGCTAGCATGCAT

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin


    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
46 views
0 likes
Last Post seqadmin  
Working...
X