Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Minimum Read Length for BWA

    Hi all,

    I am preprocessing a dataset from a human sample sequenced by Illumina HiSeq 2500 (Paired-end reads, 100bp each). I first trim each read based on quality. If the trimmed sequence is too short, I just discard it.

    My question is how do you pick the threshold length to discard? Would you discard reads shorter than 50, 40, or 30? What is the right approach to pick a threshold?

    I haven't been able to find any information on this on the web. (By the way, I am using BWA for alignment.)

    Thanks in advance.
    Last edited by persorrels; 10-03-2013, 03:38 PM. Reason: Clarification

  • #2
    Hey persorrels,

    It looks like your approach of trimming the bases and discarding reads is not appropriate.

    Illumina gives more or less good quality reads except at the 1st 3-4 base positions and may be at last 2 base positions.

    --> It doesnt make sense of getting reads of size 30,40,50 after trimming 100 bp size reads.

    --> Just be concerned about the first few bases quality, if they are above Q20, you may proceed with alignment. if not above Q20, just trim those bases, that will do.

    Good luck ahead,
    Vishnu.

    Comment


    • #3
      Vishnu, thanks for your reply.

      It is true that most forward reads are of high quality. But the reverse reads aren't. Below are two examples:


      NTATATTTTCCTCTTGGTGGTATTGAAAACCAGTGAGCAGAGAGCATAAGAACAGAACTTCAAGACCGTGGCAGGAGCTTGTATTTGTACAGCACAAACCC
      +
      #+12??A;A>@>C>CBBBA=?CBBBBBBCBAAA@ABBBB>ABB;=BBBB<=A;=AA>==AAAB=>AAAA################################




      NAAGGAGCAGCTGCGTGCCGCGTGAGCTTTAGCAGGAGGACCAGTGATTAGCATTTACGATGCAAAGACAGAACAACTTCGTATAGGACTGTACCCCTGGA
      +
      #+1<?7AA<CBABBC<CCAAA=)?153*=A?A#####################################################################


      It is an extreme example, but you can recover a 18bp region (AA<CBABBC<CCAAA=) from the second read. I guess what you're saying is, if I had to trim a large portion of the read, I should ignore it entirely.

      Is that correct?

      Also, I suspect short reads like this will affect the performance of BWA. I want to understand how the read length distibution affects the performance of BWA.

      Any comments on that?

      Cheers,

      Per

      Comment


      • #4
        Hey persorrels,

        what is the organism you have sequenced, what is the coverage.

        how much is the data size. how many reads does your data have ?

        why are you seeing individual reads.

        Initially, you need to run a quality check on your entire reads together of Read1 and Read2 individually.
        then see the quality output chart, then proceed for trimming.

        Best,
        vishnu.

        Comment


        • #5
          You can usually use the default minimum size of whatever trimmer you're using as a guide. Often minimum sizes of 20 or 30 are used (I wouldn't bother going much lower than that, since anything shorter will probably just become a multi-mapper).

          Comment


          • #6
            Human, 10x exome. Total sequence size is about 30Gb. 100bp per read. Attached are some sample statistics from reverse reads.
            Attached Files

            Comment


            • #7
              Hey persorrels,

              If i was in your place, i proceed this way.

              I suggest you trim the first 4 bases and run FASTQC on the trimmed file and checked the QC chart.

              --> If you see the mean quality- the blue line it falls more or less near 30, above 28.
              --> The median quality- the red line is above 30 for all bases.

              That means, only certain reads bases of the file are not of good quality.

              But, any how trim the first 4 bases, align and see.
              Do it. You will learn a lot by going.

              Best,
              Vishnu.

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Exploring the Dynamics of the Tumor Microenvironment
                by seqadmin




                The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
                07-08-2024, 03:19 PM
              • seqadmin
                Exploring Human Diversity Through Large-Scale Omics
                by seqadmin


                In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
                06-25-2024, 06:43 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, 07-19-2024, 07:20 AM
              0 responses
              39 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 07-16-2024, 05:49 AM
              0 responses
              51 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 07-15-2024, 06:53 AM
              0 responses
              61 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 07-10-2024, 07:30 AM
              0 responses
              43 views
              0 likes
              Last Post seqadmin  
              Working...
              X