Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Minimum Read Length for BWA

    Hi all,

    I am preprocessing a dataset from a human sample sequenced by Illumina HiSeq 2500 (Paired-end reads, 100bp each). I first trim each read based on quality. If the trimmed sequence is too short, I just discard it.

    My question is how do you pick the threshold length to discard? Would you discard reads shorter than 50, 40, or 30? What is the right approach to pick a threshold?

    I haven't been able to find any information on this on the web. (By the way, I am using BWA for alignment.)

    Thanks in advance.
    Last edited by persorrels; 10-03-2013, 03:38 PM. Reason: Clarification

  • #2
    Hey persorrels,

    It looks like your approach of trimming the bases and discarding reads is not appropriate.

    Illumina gives more or less good quality reads except at the 1st 3-4 base positions and may be at last 2 base positions.

    --> It doesnt make sense of getting reads of size 30,40,50 after trimming 100 bp size reads.

    --> Just be concerned about the first few bases quality, if they are above Q20, you may proceed with alignment. if not above Q20, just trim those bases, that will do.

    Good luck ahead,
    Vishnu.

    Comment


    • #3
      Vishnu, thanks for your reply.

      It is true that most forward reads are of high quality. But the reverse reads aren't. Below are two examples:


      NTATATTTTCCTCTTGGTGGTATTGAAAACCAGTGAGCAGAGAGCATAAGAACAGAACTTCAAGACCGTGGCAGGAGCTTGTATTTGTACAGCACAAACCC
      +
      #+12??A;A>@>C>CBBBA=?CBBBBBBCBAAA@ABBBB>ABB;=BBBB<=A;=AA>==AAAB=>AAAA################################




      NAAGGAGCAGCTGCGTGCCGCGTGAGCTTTAGCAGGAGGACCAGTGATTAGCATTTACGATGCAAAGACAGAACAACTTCGTATAGGACTGTACCCCTGGA
      +
      #+1<?7AA<CBABBC<CCAAA=)?153*=A?A#####################################################################


      It is an extreme example, but you can recover a 18bp region (AA<CBABBC<CCAAA=) from the second read. I guess what you're saying is, if I had to trim a large portion of the read, I should ignore it entirely.

      Is that correct?

      Also, I suspect short reads like this will affect the performance of BWA. I want to understand how the read length distibution affects the performance of BWA.

      Any comments on that?

      Cheers,

      Per

      Comment


      • #4
        Hey persorrels,

        what is the organism you have sequenced, what is the coverage.

        how much is the data size. how many reads does your data have ?

        why are you seeing individual reads.

        Initially, you need to run a quality check on your entire reads together of Read1 and Read2 individually.
        then see the quality output chart, then proceed for trimming.

        Best,
        vishnu.

        Comment


        • #5
          You can usually use the default minimum size of whatever trimmer you're using as a guide. Often minimum sizes of 20 or 30 are used (I wouldn't bother going much lower than that, since anything shorter will probably just become a multi-mapper).

          Comment


          • #6
            Human, 10x exome. Total sequence size is about 30Gb. 100bp per read. Attached are some sample statistics from reverse reads.
            Attached Files

            Comment


            • #7
              Hey persorrels,

              If i was in your place, i proceed this way.

              I suggest you trim the first 4 bases and run FASTQC on the trimmed file and checked the QC chart.

              --> If you see the mean quality- the blue line it falls more or less near 30, above 28.
              --> The median quality- the red line is above 30 for all bases.

              That means, only certain reads bases of the file are not of good quality.

              But, any how trim the first 4 bases, align and see.
              Do it. You will learn a lot by going.

              Best,
              Vishnu.

              Comment

              Latest Articles

              Collapse

              • seqadmin
                Best Practices for Single-Cell Sequencing Analysis
                by seqadmin



                While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
                06-06-2024, 07:15 AM
              • seqadmin
                Latest Developments in Precision Medicine
                by seqadmin



                Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                Somatic Genomics
                “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                05-24-2024, 01:16 PM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by seqadmin, Yesterday, 07:24 AM
              0 responses
              10 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 06-13-2024, 08:58 AM
              0 responses
              11 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 06-12-2024, 02:20 PM
              0 responses
              16 views
              0 likes
              Last Post seqadmin  
              Started by seqadmin, 06-07-2024, 06:58 AM
              0 responses
              184 views
              0 likes
              Last Post seqadmin  
              Working...
              X