gtf_to_fasta returned an error

[SpreeFu]

I can't tell you what, if anything, you need to change yet. You need to simply run

/home/jana/Software/tophat-2.0.9.Linux_x86_64/gtf_to_fasta --min-anchor 8 --splice-mismatches 0 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.15 --output-dir SP2_131004_2thout/ --max-multihits 20 --max-seg-multihits 40 --segment-length 25 --segment-mismatches 2 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --read-mismatches 2 --read-gap-length 2 --read-edit-dist 2 --read-realign-edit-dist 3 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p8 --inner-dist-mean 50 --inner-dist-std-dev 20 --gtf-annotations PLncDB.gff --gtf-juncs 0SP2_131004_2thout/tmp/PLncDB.juncs --no-closure-search --no-coverage-search --no-microexon-search PLncDB.gff genome.fa SP2_131004_2thout/tmp/PLncDB.fa > SP2_131004_2thout/logs/g2f.out

to see what the underlying error message is. Then you can figure out what's actually wrong.

After replacing 'Parent' to 'ID', new error came....

[2013-10-04 20:31:29] Building Bowtie index from PLncDB.fa
[FAILED]
Error: Couldn't build bowtie index with err = 1

then I ran log, present:

Settings:
Output files: "SP2_131004_2thout/tmp/PLncDB.*.bt2"
Line rate: 6 (line is 64 bytes)
Lines per side: 1 (side is 64 bytes)
Offset rate: 4 (one in 16)
FTable chars: 10
Strings: unpacked
Max bucket size: default
Max bucket size, sqrt multiplier: default
Max bucket size, len divisor: 4
Difference-cover sample period: 1024
Endianness: little
Actual local endianness: little
Sanity checking: disabled
Assertions: disabled
Random seed: 0
Sizeofs: void*:8, int:4, long:8, size_t:8
Input files DNA, FASTA:
SP2_131004_2thout/tmp/PLncDB.fa
Warning: Empty fasta file: 'SP2_131004_2thout/tmp/PLncDB.fa'
Warning: All fasta inputs were empty
Total time for call to driver() for forward index: 00:00:00
Error: Encountered internal Bowtie 2 exception (#1)

Is here means that I have to generate an new index, with exactly the same name as PLncDB, but not previous built genome?

[SpreeFu]

I can't tell you what, if anything, you need to change yet. You need to simply run

/home/jana/Software/tophat-2.0.9.Linux_x86_64/gtf_to_fasta --min-anchor 8 --splice-mismatches 0 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.15 --output-dir SP2_131004_2thout/ --max-multihits 20 --max-seg-multihits 40 --segment-length 25 --segment-mismatches 2 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --read-mismatches 2 --read-gap-length 2 --read-edit-dist 2 --read-realign-edit-dist 3 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p8 --inner-dist-mean 50 --inner-dist-std-dev 20 --gtf-annotations PLncDB.gff --gtf-juncs 0SP2_131004_2thout/tmp/PLncDB.juncs --no-closure-search --no-coverage-search --no-microexon-search PLncDB.gff genome.fa SP2_131004_2thout/tmp/PLncDB.fa > SP2_131004_2thout/logs/g2f.out

to see what the underlying error message is. Then you can figure out what's actually wrong.

It showed Error: no ID found for GFF record start
So I have to change 'Parent=' to 'ID='?
Do I need add the line '1 TAIR10 Chromosome 1 30427671 . . . ID=chr1;Name=Chr1' as in TAIR10_genes.gff?

[dpryan]

I can't tell you what, if anything, you need to change yet. You need to simply run

/home/jana/Software/tophat-2.0.9.Linux_x86_64/gtf_to_fasta --min-anchor 8 --splice-mismatches 0 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.15 --output-dir SP2_131004_2thout/ --max-multihits 20 --max-seg-multihits 40 --segment-length 25 --segment-mismatches 2 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --read-mismatches 2 --read-gap-length 2 --read-edit-dist 2 --read-realign-edit-dist 3 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p8 --inner-dist-mean 50 --inner-dist-std-dev 20 --gtf-annotations PLncDB.gff --gtf-juncs 0SP2_131004_2thout/tmp/PLncDB.juncs --no-closure-search --no-coverage-search --no-microexon-search PLncDB.gff genome.fa SP2_131004_2thout/tmp/PLncDB.fa > SP2_131004_2thout/logs/g2f.out

to see what the underlying error message is. Then you can figure out what's actually wrong.

[SpreeFu]

If you look in the run log, you'll see the exact gtf_to_fasta command that's run. Simply run that yourself to find out what the actual (usually more informative) error message is.

Hi Ryan, thanks for your reply!

I got the run log
#>map_start:
/home/jana/Software/tophat-2.0.9.Linux_x86_64/gtf_to_fasta --min-anchor 8 --splice-mismatches 0 --min-report-intron 50 --max-report-intron 500000 --min-isoform-fraction 0.15 --output-dir SP2_131004_2thout/ --max-multihits 20 --max-seg-multihits 40 --segment-length 25 --segment-mismatches 2 --min-closure-exon 100 --min-closure-intron 50 --max-closure-intron 5000 --min-coverage-intron 50 --max-coverage-intron 20000 --min-segment-intron 50 --max-segment-intron 500000 --read-mismatches 2 --read-gap-length 2 --read-edit-dist 2 --read-realign-edit-dist 3 --max-insertion-length 3 --max-deletion-length 3 -z gzip -p8 --inner-dist-mean 50 --inner-dist-std-dev 20 --gtf-annotations PLncDB.gff --gtf-juncs 0SP2_131004_2thout/tmp/PLncDB.juncs --no-closure-search --no-coverage-search --no-microexon-search PLncDB.gff genome.fa SP2_131004_2thout/tmp/PLncDB.fa > SP2_131004_2thout/logs/g2f.out

Do you mean I have to change the parameters, because my gff file is not somehow standard?

[dpryan]

If you look in the run log, you'll see the exact gtf_to_fasta command that's run. Simply run that yourself to find out what the actual (usually more informative) error message is.

[SpreeFu]

BTW, tophat ran soomthly when I used TAIR10_GFF3_genes.gff.

[SpreeFu]

Hi all,
Could you help me to solve the problem show as following please?

Here is the error:
$ tophat -p 8 -G PLncDB.gff -o SP2_131004_2thout --no-novel-juncs genome SP2_R1_PE100_clipped.fastq SP2_R2_PE100_clipped.fastq

[2013-10-04 18:27:48] Beginning TopHat run (v2.0.9)
-----------------------------------------------
[2013-10-04 18:27:48] Checking for Bowtie
Bowtie version: 2.1.0.0
[2013-10-04 18:27:48] Checking for Samtools
Samtools version: 0.1.18.0
[2013-10-04 18:27:48] Checking for Bowtie index files (genome)..
[2013-10-04 18:27:48] Checking for reference FASTA file
[2013-10-04 18:27:48] Generating SAM header for genome
format: fastq
quality scale: phred33 (default)
[2013-10-04 18:27:49] Reading known junctions from GTF file
Warning: TopHat did not find any junctions in GTF file
[2013-10-04 18:27:49] Preparing reads
left reads: min. length=12, max. length=100, 36930071 kept reads (3968 discarded)
right reads: min. length=12, max. length=100, 36922334 kept reads (11705 discarded)
Warning: short reads (<20bp) will make TopHat quite slow and take large amount of memory because they are likely to be mapped in too many places
[2013-10-04 18:45:24] Building transcriptome data files..
[FAILED]
Error: gtf_to_fasta returned an error.

I used self-made gff, here is part of it:
1 PlncDB LincRNA 2497 2816 . - . Parent=At1NC000020
1 PlncDB LincRNA 11100 11372 . + . Parent=At1NC000060
1 PlncDB LincRNA 43086 43295 . - . Parent=At1NC000160
1 PlncDB LincRNA 51391 51733 . + . Parent=At1NC000200
1 PlncDB LincRNA 90168 90401 . - . Parent=At1NC000340
1 PlncDB LincRNA 91355 91685 . - . Parent=At1NC000350
1 PlncDB LincRNA 107634 107877 . - . Parent=At1NC000410
1 PlncDB LincRNA 135708 136008 . - . Parent=At1NC000530
1 PlncDB LincRNA 140482 140691 . + . Parent=At1NC000560
1 PlncDB LincRNA 207751 208011 . - . Parent=At1NC000780
1 PlncDB LincRNA 217908 218112 . - . Parent=At1NC000810

Here is Arabidopsis Genome
$ head genome.fa
>1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAATCTTTAAATCC
TACATCCATGAATCCCTAAATACCTAATTCCCTAAACCCGAAACCGGTTTCTCTGGTTGAAAATCATTGT
GTATATAATGATAATTTTATCGTTTTTATGTAATTGCTTATTGTTGTGTGTAGATTTTTTAAAAATATCATTT
GAGGTCAATACAAATCCTATTTCTTGTGGTTTTCTTTCCTTCACTTAGCTATGGATGGTTTATCTTCATTTG
TTATATTGGATACAAGCTTTGCTACGATCTACATTTGGGAATGTGAGTCTCTTATTGTAACCTTAGGGTTG
GTTTATCTCAAGAATCTTATTAATTGTTTGGACTGTTTATGTTTGGACATTTATTGTCATTCTTACTCCTTTG
TGGAAATGTTTGTTCTATCAATTTATCTTTTGTGGGAAAATTATTTAGTTGTAGGGATGAAGTCTTTCTTCG
TTGTTGTTACGCTTGTCATCTCATCTCTCAATGATATGG

How can I solve this problem?

Thanks in advance!