Code:
10-09-13: Version 0.3.3 released
Fixed a bug what was accidentally introduced which would add an additional empty line in single-end trimming mode
-
This was a bug that had been introduced accidentally... If you get the latest version of Trim Galore it should be fine, sorry for the inconvenience caused. This is from the latest release notes:
-
The simplest way might be to use awk? (but will be slow)
something like that, I haven't tested the code though...awk '{if(length($0)>=1)print $0}' input.fqLeave a comment:
-
Trim Galore output issue
I have both RRBS and RNAseq datasets that I'm trying to filter for quality and trim adaptors using Trim Galore. When I run it on the RRBS fq files using the --RRBS option, the resulting fq output looks fine:
@HWI-ST330:336
274FACXX:3:1101:13152:1997 1:N:0:CTTGTA
NGGGTTGTTTTATGGAGAGCGGAGGGT
+
#4=DDDFDHHHHHJJIJIIGJJIIJJ?
@HWI-ST330:336274FACXX:3:1101:14593:1999 1:N:0:CTTGTA
NGGTAATTCGTTTTTTATAAGGCGAAT
+
#1=DFFFFHHHHHJJJJJJJHGIJJJJ
@HWI-ST330:336274FACXX:3:1101:18911:1998 1:N:0:CTTGTA
NGGGGTTTAGACGTAGTAGGTGTTTT
+
#1=DFDDFHHHHHGHJGHIJAFFHIJ
But when I run it on the RNAseq samples without the --RRBS option, there are additional spaces in the fastq output:
@DBRHHJN1:326:C233EACXX:1:1101:1305:1193 1:N:0:ATCACG
CTTTNTGTGGCTCAGGATGGAGGTGGCCACATTGGCCAGCAACTCAGCCAGGCCGGGGCCTTCCTTCCCAGCAATTCGAGGCGCGGCCAGCGCCTGCCGC
+
???D#2=ADDDDDIIIIEFIEEF+CEDE>[email protected]>@?AAAAAAA?AA=??AAA?E?>5;>;>95;8<;;>>???>>
@DBRHHJN1:326:C233EACXX:1:1101:1287:1222 1:N:0:ATCACG
CTTGNAAATGGCGTCAAAGGTGGCCTTGGCGAAGTTGCCCAGGGTGGCAGTGCAGCCCCTGGCAGAGGTGTAGCAGTCATCAATTCCTGCCATCATCAGC
+
?@@D#2=AFHH?FH<[email protected]@)?DHI9?BCFGIHII=@?7A;7?>BB?ACCA=?(98,<C:C:5,53:@>>4:@::@@CB>@93>>:::
@DBRHHJN1:326:C233EACXX:1:1101:1252:1244 1:N:0:ATCACG
I've tried running it a few different ways, and discovered that I only get the output with added spaces when I don't use the --RRBS option. My question is how do I fix this issue? I don't want to use the --RRBS option with the RNAseq data, as it will remove an additional 2bp from the trimmed reads. Is there a way to prevent Trim Galore from adding these spaces? Or is there a way for me to remove the spaces from the output files? Thanks!
-
Developments in sequencing technologies and methodologies have transformed the field of epigenetics, giving researchers a better way to understand the complex world of gene regulation and heritable modifications. This article explores some of the diverse sequencing methods employed in the study of epigenetics, ranging from classic techniques to cutting-edge innovations while providing a brief overview of their processes, applications, and advances.
Methylation Detect...05-31-2023, 10:46 AM -
Differential Expression and Data Visualization: Recommended Tools for Next-Level Sequencing Analysis
After covering QC and alignment tools in the first segment and variant analysis and genome assembly in the second segment, we’re wrapping up with a discussion about tools for differential gene expression analysis and data visualization. In this article, we include recommendations from the following experts: Dr. Mark Ziemann, Senior Lecturer in Biotechnology and Bioinformatics, Deakin University; Dr. Medhat Mahmoud Postdoctoral Research Fellow at Baylor College of Medicine;...05-23-2023, 12:26 PM -
Continuing from our previous article, we share variant analysis and genome assembly tools recommended by our experts Dr. Medhat Mahmoud, Postdoctoral Research Fellow at Baylor College of Medicine, and Dr. Ming "Tommy" Tang, Director of Computational Biology at Immunitas and author of From Cell Line to Command Line.
Variant detection and analysis tools
Mahmoud classifies variant detection work into two main groups: short variants (<50...05-19-2023, 10:03 AM
Leave a comment: