Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • vishnuamaram
    replied
    Hey keerthi,

    This is Vishnu, involved in human whole genome analysis for SNPs

    My pipeline steps are fine starting with FASTC-bwa-samtools-picard-GATK,where i get errors at GATK indel realignment.

    Will you please kindly let me know the proper commands and things to know and perform indelrealignment using GATK.

    Thanking you,
    Vishnu.

    Leave a comment:


  • Keerthi
    started a topic Errors while running PrintReads walker of GATK

    Errors while running PrintReads walker of GATK

    I ran BaseRecalibrator on some of my realigned bam files, there were no errors reported while running it and I was to able to generate the "recal.grp" files. However, while running the PrintReads walker to generate the recalibrated BAM files, I get the following error message for some of the BAMs.

    Code:
    ##### ERROR MESSAGE: Exception when processing alignment for BAM index WTCHG_35305_101:4:1105:10332:129428#TGTTAACT 2/2 100b aligned read.
    Here are the sam entries for reads with that name:

    Code:
    WTCHG_35307_101:6:1203:13886:24459#TGTTAACT     163     chr10   18018023        60      100M    =       18018207        284     GCTCACAGGGCTTTCTATTTTATCAGAAAGACTCTGCTCACAATGGAAGTGACCTTTGCAACCCCACCCATGGCTCAGCTCAGATCTGACTCACAGGGAA      ;<7DDD?+=;:F=BF,2:CDFH9HDCF+CF;?EHG<CCFHIGEDB*?BB0?FDDDFHIEHCFEHGIEE<C;=;9777;@;>>6>>>>>>C(;>:@#####      RG:Z:WTCHG_35307_101    NM:i:3  SM:i:37 MQ:i:60 PQ:i:154        UQ:i:99 XQ:i:36
    WTCHG_36044_101:6:2206:16781:169559#TGTTAACT    83      chr10   18018032        60      22M2D78M        =       18017955        -179    GCTTTCTATTTTATCAGAAAGACTGCCCAGGATGGAAGTGACCTTTGCAACCCCACCCATGGCTCAGCTCAGATCTGACTCACAGGGAAAGCTGCTCCTG      ?>C@DDDDC@C@DCCDDDDDCC>?;5(CC@@A;@DFEE>ECHCEGD@B@@GGAEDIIIJIHGCCHFBFBAIF@EGGHHEEGFDIFGIDHHHDDDD7?@@<      RG:Z:WTCHG_36044_101    NM:i:4  SM:i:37 MQ:i:60 PQ:i:126        UQ:i:57 XQ:i:37
    [B]WTCHG_35305_101:4:1105:10332:129428#TGTTAACT[/B]    99      chr10   18018034        99      23M2D77M        =       18018104        170     TTTCTATTTTATCAGAAAGACTGCCCAGGATGGAAGTGACCTTTGCAACCCCACCCATGGCTCAGCTCAGATCTGACTCACAGGGAAAGCTGCTCCTGCC      @@@FFDEFHHHHHJJIIIJEGHGIIGHIIEGHDAFHFHHJJJIFEII>BGDFIIGG;FHHCFGHIEIHHHEECEFBBDFEECEDDBBDDDCDDC@CCC@<      RG:Z:WTCHG_35305_101    NM:i:4  SM:i:67 MQ:i:99 PQ:i:179        UQ:i:126        XQ:i:78
    WTCHG_34275_101:8:2207:10530:171933#TGTTAACT    99      chr10   18018037        99      100M    =       18018096        160     CTATTTTATCAGAAAGACTCTGCTCACAATGGAAGTGACCTTTGCAACCCCACCCATGGCTCAGCTCAGATCTGACTCACAGGGAAAGCTGCTCCTGCCC      CCCFFFFFHHHFHIJBBCHGIJIJIEGIJIIGHIHHCHIGIJIFIIIHGGHIIJBHIIEGEHIJCGGIIEECHHDADDEFEFDDDDDDCCCDDCDDCCB?      RG:Z:WTCHG_34275_101    NM:i:3  SM:i:96 MQ:i:109        PQ:i:209        UQ:i:122        XQ:i:125
    WTCHG_36040_101:2:1108:12445:188643#TGTTAACT    147     chr10   18018038        60      100M    =       18017896        -242    TATTTTATCAGAAAGACTCTGCTCACAATGGAAGTGACCTTTGCAACCCCACCCATGGCTCAGCTCAGATCTGACTCACAGGGAAAGCTGCTCCTGCCCT      A>@CCAC>CDAC@AA>ACCCDDDC@CADDECCC@;..?@DDA?E@;GFB@DGGDD;?@;FBBHGHDHIIHEEBEH@EA?EGIGGGGGFHHF?DDFDD@@<      RG:Z:WTCHG_36040_101    NM:i:3  SM:i:37 MQ:i:60 PQ:i:235        UQ:i:102        XQ:i:111
    --
    WTCHG_35304_101:3:2206:8473:5078#TGTTAACT       99      chr10   18018102        60      46M1D54M        =       18018223        221     TCAGATCTGACTCACAGGGAAAGCTGCTCCTGCCCTGCTGCTTCCTGATCCTGGAAAAGGCTCTGCTGTGAGCAAGAGTTGAACTGGAAAAGTTAAAGAG      @@CFFADDFHFHHIDGGIIGIGHDHIGIDIGIIIGBDFFHECFGGIBBBGHGHEHCHGCEGCCHIIGEG>A;=AC@DDDFA;;;@ACCCDCD@AACDCD<      RG:Z:WTCHG_35304_101    NM:i:3  SM:i:37 MQ:i:60 PQ:i:138        UQ:i:75 XQ:i:39
    WTCHG_35303_101:2:1204:8538:13106#TGTTAACT      99      chr10   18018103        60      45M1D55M        =       18018142        140     CAGATCTGACTCACAGGGAAAGCTGCTCCTGCCCTGCTGCTTCCTGATCCTGGAAAAGGCTCTGCTGTGAGCAAGAGTTGAACTGGAAAAGTTAAAGAGT      @@@??DDDBFHHHIGGIIDCFEHACEIGCBEGHIBHIICCDBGGGGCAHIII@8*BFGCFGHCFDCEHIEFEF@EEE@CCC;@AC<ACC;;;AD@C:3<@      RG:Z:WTCHG_35303_101    NM:i:3  SM:i:37 MQ:i:60 PQ:i:184        UQ:i:71 XQ:i:73
    [B]WTCHG_35305_101:4:1105:10332:129428#TGTTAACT[/B]    147     chr10   18018104        99      100M    =       18018034        -170    AGATCTGACTCACAGGGAAAGCTGCTCCTGCCCTGCTGCTTCCTGGATCCTGGAAAAGGCTCTGTTGTGAGCAAGAGTTGAACTGGAAAAGTTAAAGAGT      >:3ACA>:>;;;A>>;3CAE@@CBEBEHAD;DAHF@8=AJHGGGF>HD?99GEGCHEGC?@JGIHGHCGEEIJIIHH<C@HHIJJGHHAFAFDFFFFB@@      RG:Z:WTCHG_35305_101    NM:i:2  SM:i:96 MQ:i:99 PQ:i:179        UQ:i:78 XQ:i:126
    WTCHG_36040_101:2:1203:13822:152632#TGTTAACT    99      chr10   18018121        60      27M1D73M        =       18018325        304     AAAGCTGCTCCTGCCCTGCTGCTTCCTGATCCTGGAAAAGGCTCTGCTGTGAGCAAGAGTTGAACTGGAAAAGTTAAAGAGTTGTTTAACAGGAGGGACT      @?@DDDDDF??:CFD@<CA<CAEFEI+<A<1:19*?D>BGF3BFB>B>F?D@??B=@BA)=)8.@@EE3=C>ACEAE:3;?));;?@>:@AB########      RG:Z:WTCHG_36040_101    NM:i:3  SM:i:37 MQ:i:60 PQ:i:155        UQ:i:65 XQ:i:72
    WTCHG_36043_101:5:2108:5276:30273#TGTTAACT      147     chr10   18018125        99      100M    =       18018059        -166    CTGCTCCTGCCCTGCTGCTTCCTGGATCCTGGAAAAGGCTCTGTTGTGAGCAAGAGTTGAACTGGAAAAGTTAAAGAGTTGTTTAACAGGAGGGATTGCT      DDDDBBDDDDDEEEEEFFEFHHGFH@IIIJJJJJIGJJJIIIJIJJIJIIJIJJJJJJIIJJJJJJIJJJIGJJJIJJJIIJJJIJJHHHHHFFFFFC@@      RG:Z:WTCHG_36043_101    NM:i:3  SM:i:96 MQ:i:99 PQ:i:209        UQ:i:118        XQ:i:121
    So, I tried to validate my realigned BAM as well as the original BAM (before realignment) using Picard's ValidateSAMFile and I get the following errors:

    original BAM: Mate unmapped flag does not match read unmapped flag of mate, Mate alignment does not match alignment start of mate, Mate negative strand flag does not match read negative strand flag of mate

    Aditionally these errors on realigned BAMs: Mate reference index (MRNM) does not match reference index of mate, Mate not found for paired read

    I ran Picard's FixMateInformation step on the realigned BAM's to fix the above issues and validated the BAM's again. However, I still seem to get the following error: Mate not found for paired read and the PrintReads walker of GATK exits throwing similar errors as mentioned earlier.

    I am not sure what the GATK error says. Any ideas on how to solve this would be greatly appreciated.

Latest Articles

Collapse

  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
35 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
38 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
33 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
54 views
0 likes
Last Post seqadmin  
Working...
X