Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bowtie2 fragment length

    Dear Bowtie2 user,

    I have a question regarding the fragment length issue.

    The reads that mapped to the different chromosomes sometimes have a fragment length of 0 but sometimes non-0. From the bowtie2 manuel
    I understand that the fragment length has to be non-0 if the mates mapped to the same chromosome.

    "Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome."

    Here is an example from my bowtie2 output:
    Example for 0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 65 chr9 71742006 24 22M = 3007124 0 TTAATGTCTGTCTCCCTTACTG FFBFFFFGGGGFGGGGGHHHHG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:21A0 YT:Z:UP
    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 129 chr9 3007124 0 29M = 71742006 0 TCGTCATTTTTCAAGTCGTCAAGGGGATG ABBBBBFFFFFFGGGGGGGGGGCHFEEGG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:23T5 YT:Z:UP

    Example for non-0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 65 chr14 54510108 42 23M = 52820128 -1690003 TTAAAGGTAAAAACCACCAACAT BFAFFFF1BGGGGFEF1AGFEGH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:23 YS:i:0 YT:Z: DP
    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 129 chr14 52820128 42 31M = 54510108 1690003 CCTTGGAAGCCCACTGGAAAAAATGACAGAT AAABAFFFFCFBGGGGGGGGGGGHHHHGHFG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:31 YS:i:0 YT:Z: DP

    Do I miss something or is it a bowtie2 bug?

    Thanks in advance,

    Mary

  • #2
    Well both examples are discordant within the same chromosome (chr9 for the first example, chr14 for the second). However in your first example the MAPQ of the second read is 0. This may cause bowtie2 to not want to infer a TLEN (fragment size) thus setting it to 0.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Exploring the Dynamics of the Tumor Microenvironment
      by seqadmin




      The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
      07-08-2024, 03:19 PM
    • seqadmin
      Exploring Human Diversity Through Large-Scale Omics
      by seqadmin


      In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
      06-25-2024, 06:43 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 07-10-2024, 07:30 AM
    0 responses
    30 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-03-2024, 09:45 AM
    0 responses
    201 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-03-2024, 08:54 AM
    0 responses
    212 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 07-02-2024, 03:00 PM
    0 responses
    194 views
    0 likes
    Last Post seqadmin  
    Working...
    X