Header Leaderboard Ad
Collapse
bowtie2 fragment length
Collapse
Announcement
Collapse
SEQanswers June Challenge Has Begun!
The competition has begun! We're giving away a $50 Amazon gift card to the member who answers the most questions on our site during the month. We want to encourage our community members to share their knowledge and help each other out by answering questions related to sequencing technologies, genomics, and bioinformatics. The competition is open to all members of the site, and the winner will be announced at the beginning of July. Best of luck!
For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)
For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)
See more
See less
X
-
Well both examples are discordant within the same chromosome (chr9 for the first example, chr14 for the second). However in your first example the MAPQ of the second read is 0. This may cause bowtie2 to not want to infer a TLEN (fragment size) thus setting it to 0.
-
bowtie2 fragment length
Dear Bowtie2 user,
I have a question regarding the fragment length issue.
The reads that mapped to the different chromosomes sometimes have a fragment length of 0 but sometimes non-0. From the bowtie2 manuel
I understand that the fragment length has to be non-0 if the mates mapped to the same chromosome.
"Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome."
Here is an example from my bowtie2 output:
Example for 0 fragment length
MISEQ:52:000000000-A4DCH:1:1101:16444:3647 65 chr9 71742006 24 22M = 3007124 0 TTAATGTCTGTCTCCCTTACTG FFBFFFFGGGGFGGGGGHHHHG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:21A0 YT:Z:UP
MISEQ:52:000000000-A4DCH:1:1101:16444:3647 129 chr9 3007124 0 29M = 71742006 0 TCGTCATTTTTCAAGTCGTCAAGGGGATG ABBBBBFFFFFFGGGGGGGGGGCHFEEGG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:23T5 YT:Z:UP
Example for non-0 fragment length
MISEQ:52:000000000-A4DCH:1:1101:17281:1944 65 chr14 54510108 42 23M = 52820128 -1690003 TTAAAGGTAAAAACCACCAACAT BFAFFFF1BGGGGFEF1AGFEGH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:23 YS:i:0 YT:Z: DP
MISEQ:52:000000000-A4DCH:1:1101:17281:1944 129 chr14 52820128 42 31M = 54510108 1690003 CCTTGGAAGCCCACTGGAAAAAATGACAGAT AAABAFFFFCFBGGGGGGGGGGGHHHHGHFG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:31 YS:i:0 YT:Z: DP
Do I miss something or is it a bowtie2 bug?
Thanks in advance,
Mary
Latest Articles
Collapse
-
by seqadmin
Developments in sequencing technologies and methodologies have transformed the field of epigenetics, giving researchers a better way to understand the complex world of gene regulation and heritable modifications. This article explores some of the diverse sequencing methods employed in the study of epigenetics, ranging from classic techniques to cutting-edge innovations while providing a brief overview of their processes, applications, and advances.
Methylation Detect...-
Channel: Articles
05-31-2023, 10:46 AM -
-
Differential Expression and Data Visualization: Recommended Tools for Next-Level Sequencing Analysisby seqadmin
After covering QC and alignment tools in the first segment and variant analysis and genome assembly in the second segment, we’re wrapping up with a discussion about tools for differential gene expression analysis and data visualization. In this article, we include recommendations from the following experts: Dr. Mark Ziemann, Senior Lecturer in Biotechnology and Bioinformatics, Deakin University; Dr. Medhat Mahmoud Postdoctoral Research Fellow at Baylor College of Medicine;...-
Channel: Articles
05-23-2023, 12:26 PM -
-
by seqadmin
Continuing from our previous article, we share variant analysis and genome assembly tools recommended by our experts Dr. Medhat Mahmoud, Postdoctoral Research Fellow at Baylor College of Medicine, and Dr. Ming "Tommy" Tang, Director of Computational Biology at Immunitas and author of From Cell Line to Command Line.
Variant detection and analysis tools
Mahmoud classifies variant detection work into two main groups: short variants (<50...-
Channel: Articles
05-19-2023, 10:03 AM -
ad_right_rmr
Collapse
News
Collapse
Topics | Statistics | Last Post | ||
---|---|---|---|---|
Started by seqadmin, Today, 07:14 AM
|
0 responses
4 views
0 likes
|
Last Post
by seqadmin
Today, 07:14 AM
|
||
Started by seqadmin, Yesterday, 01:08 PM
|
0 responses
6 views
0 likes
|
Last Post
by seqadmin
Yesterday, 01:08 PM
|
||
Started by seqadmin, 06-01-2023, 08:56 PM
|
0 responses
34 views
0 likes
|
Last Post
by seqadmin
06-01-2023, 08:56 PM
|
||
Deep Sequencing Unearths Novel Genetic Variants: Enhancing Precision Medicine for Vascular Anomalies
by seqadmin
Started by seqadmin, 06-01-2023, 07:33 AM
|
0 responses
169 views
0 likes
|
Last Post
by seqadmin
06-01-2023, 07:33 AM
|
Leave a comment: