Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • GenoMax
    replied
    Originally posted by na_sd View Post
    Thanks.
    I am not convinced because my file is not like general fasta file. It has ONLY one line with '>'. The person has asked me about the number of contigs in this file and I am sure that it is greater than 1.
    I wish you had downloaded the file and then answered my question.
    If there is only one line starting with ">" in your file then

    a> Your file is either incomplete or
    b> the sequence got assembled as a single contig

    note: You appear to have removed the file from dropbox.
    Last edited by GenoMax; 09-23-2016, 06:23 AM.

    Leave a comment:


  • na_sd
    replied
    Originally posted by GenoMax View Post
    @Brian and I had answered some of these questions in your Biostars post but looks like you are not convinced. The answers are still going to be the same.

    If you do
    Code:
    grep -c "^>" your_file
    that will give you a number for the contigs present in your file.


    That may just be the length of first contig. Does each of your contigs have such a number? We don't know if the contigs you have overlap so it may not be possible to answer this question directly.

    PS: I am not going to download the file from dropbox to test.

    Thanks.
    I am not convinced because my file is not like general fasta file. It has ONLY one line with '>'. The person has asked me about the number of contigs in this file and I am sure that it is greater than 1.
    I wish you had downloaded the file and then answered my question.

    Leave a comment:


  • GenoMax
    replied
    Originally posted by na_sd View Post
    The number of contigs

    I am given a fasta file like this file that you can download it. This file is de novo assembled genome.

    I have two very simple questions:

    1- How many contigs are present in this file? (my guess: it is equal to the number of rows in the file?!)
    @Brian and I had answered some of these questions in your Biostars post but looks like you are not convinced. The answers are still going to be the same.

    If you do
    Code:
    grep -c "^>" your_file
    that will give you a number for the contigs present in your file.
    2- what is the total genomic length of the assembly?
    (my guess: it is 'len=245876' which has been written in the first line)

    I am new in DNA sequence analysis stuff, thanks for your kind help.
    That may just be the length of first contig. Does each of your contigs have such a number? We don't know if the contigs you have overlap so it may not be possible to answer this question directly.

    PS: I am not going to download the file from dropbox to test.

    Leave a comment:


  • na_sd
    replied
    The number of contigs

    I am given a fasta file like this file that you can download it. This file is de novo assembled genome.

    I have two very simple questions:

    1- How many contigs are present in this file? (my guess: it is equal to the number of rows in the file?!)

    2- what is the total genomic length of the assembly?
    (my guess: it is 'len=245876' which has been written in the first line)

    I am new in DNA sequence analysis stuff, thanks for your kind help.

    Leave a comment:


  • morning latte
    replied
    Thanks, it works very well.

    Leave a comment:


  • martinghunt
    replied
    Here's a quick unix hack:
    grep -v ">" file.fasta | wc | awk '{print $3-$1}'

    Leave a comment:


  • morning latte
    started a topic counting total bases in a fasta file

    counting total bases in a fasta file

    Hello,

    I have a fasta file like below.

    >NODE_1476_length_303_cov_5.280528
    TTAAGTGGGATTTCGTTTAGTGAGGTAGGTACTTTTACTTGGATTTCCATAATTGTATAAG
    TCTTTTAGTCGTTTTTGTATTCCTTAGCCAATACATAAGAGTAGGCTTGAGCTAACATTTGA......
    >NODE_2306_length_339_cov_2.926254
    .
    .
    .

    I want to get total base-pair count from this file. I tried fastx toolkit but it did not work as my fasta format is not what fastx wants (guess fastx wants one line of sequences while mine has two lines of sequences). Could somebody suggest any tool or command for it? Thanks.

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 05-24-2024, 07:15 AM
0 responses
16 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
18 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
22 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
11 views
0 likes
Last Post seqadmin  
Working...
X