Header Leaderboard Ad

Collapse

Adapters trimming for BGI-seq?

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Adapters trimming for BGI-seq?

    Hi everyone,

    Recently I just received PEreads from BGI-seq, and the sequencer company provide me with this adapters index:
    No code has to be inserted here........etc.....

    So, I used those shrt sequences to trim my reads using trimmomatic in Galaxy, and prepared the fasta seq as follow for trimming:

    >index1/1
    GGTCCATT
    >index1/2
    TTAGGTAG
    >index2/1
    GGTCCATT
    >index2/2
    GGTCACTA
    >index3/1
    GGTCCATT
    >index3/2
    TCCGCACT
    ...etc...

    Did I use the information correctly? because recently I just found that others have been using:
    forward_adapter = "AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA"
    reverse_adapter = "AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG"

    to trim the adapters, not sure if its for SE only or also PE. Thank you
Working...
X