Header Leaderboard Ad

Collapse

Adapters trimming for BGI-seq?

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • uzi_maruzi
    started a topic Adapters trimming for BGI-seq?

    Adapters trimming for BGI-seq?

    Hi everyone,

    Recently I just received PEreads from BGI-seq, and the sequencer company provide me with this adapters index:
    No code has to be inserted here........etc.....

    So, I used those shrt sequences to trim my reads using trimmomatic in Galaxy, and prepared the fasta seq as follow for trimming:

    >index1/1
    GGTCCATT
    >index1/2
    TTAGGTAG
    >index2/1
    GGTCCATT
    >index2/2
    GGTCACTA
    >index3/1
    GGTCCATT
    >index3/2
    TCCGCACT
    ...etc...

    Did I use the information correctly? because recently I just found that others have been using:
    forward_adapter = "AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA"
    reverse_adapter = "AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG"

    to trim the adapters, not sure if its for SE only or also PE. Thank you

Latest Articles

Collapse

  • seqadmin
    A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
    by seqadmin


    ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

    01-24-2023, 01:19 PM
  • seqadmin
    Introduction to Single-Cell Sequencing
    by seqadmin
    Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

    The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
    ...
    01-09-2023, 03:10 PM

ad_right_rmr

Collapse
Working...
X