Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problem Picard "Alignment start should != 0 because reference name != *"


    Using Picard Validation, I obtain this message for some reads : Alignment start should != 0 because reference name != *
    If I grep the read in the SAM file, I can see that the read is mapped (there is the name of a reference scaffold in the third column) but the position (column 4) is 0.
    This is very strange, how can this happen ?
    Do you know how to fix this ?



  • #2
    What's the flag on that read?


    • #3

      After doing bwa aln and bwa sampe, I obtain a sam file and I use Picard ValidateSamFile.
      The errors are :
      ERROR: Record 38208, Read name HWI-ST1206:14:C296WACXX:6:1101:8672:9595, Mate negative strand flag does not match read negative strand flag of mate
      ERROR: Record 40751, Read name HWI-ST1206:14:C296WACXX:6:1101:8820:10033, Alignment start should != 0 because reference name != *.
      If I grep the read with the second problem, here is what I obtain :
      HWI-ST1206:14:C296WACXX:6:1101:8820:10033 113 gi|300388125|ref|NC_013991.2| 0 25 46M =176 215 GTACTTTTTTTTTTAGTATTTTAATTTTGTATTTATTATTTATATT >GCGAGGEIIIHHGHHIHE@HHC:CA<<AAGC>DFHFFDDDDD@@<RG:Z:Pa1370-Seq1 XT:A:U NM:i:0 SM:i:25 AM:i:25 X0:i:1 X1:i:1 XM:i:3 XO:i:0 XG:i:0 MD:Z:0 XA:Z:gi|300388125|ref|NC_013991.2|,-86195,4M1D42M,1;

      HWI-ST1206:14:C296WACXX:6:1101:8820:10033 177 gi|300388125|ref|NC_013991.2| 176 37 85M =0 -215 GCAGCTAGGTCTAGAGGGAAGTTGTGAGCATTACGTTCATGCATTACTTCCATACCAAGGTTAGCACGGTTGATGATACCAGCCC @@@@@>@@>;;;AA=>BBBA<BBBBAA:BA=;B=9??ABBBBBBBBAA>BA<?*BABBB>C?AC7<CC@>A>72BC@@)=<A=== RG:Z:Pa1370-Seq1 XT:A:UNM:i:1 SM:i:37 AM:i:25 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:78T6
      Any idea on how I can have a read map but no position given ???

      Thanks !



      • #4
        That would seem to be a bug.


        • #5
          OK thanks !
          Any idea on what I can do ?


          • #6
            Try emailing the list.


            • #7
              OK, i will, thanks for your help !


              • #8
                Hi Muriel,

                I am facing the same problem. Did you find a solution for it?

                Thanks and kind regards


                • #9
                  Hello !
                  Well, what I did is a personal arrangement. I should probably write to the mailing list, I don't remember if I did or not ahah !!
                  The problem is that some read are supposedly mapped on the reference because there is a scaffold name in the column 3, but the starting position (column 4) of the read is 0 and this is the problem.
                  Here is what I did :

                  ### List reads that have "Alignment start should != 0 because reference name != *"
                  samtools view -h input.bam | awk 'BEGIN {OFS="\t";} {if ($1=="^@") {print $0;} else {if ($4==0 && $3!="*") {$4=1; print $1>"read_file"} if ($8==0 && $7!="*") {$8=1;print $1>"read_file"} print $0;}}' | samtools view -bS - > input_OK.bam ; sort read_file | uniq > read_file_sorted

                  ### Exclude problematic reads
                  #java -Xmx20g -jar FilterSamReads.jar INPUT=INPUT_OK.bam FILTER=excludeReadList READ_LIST_FILE=read_file_sorted OUTPUT=output.bam

                  Good luck !



                  • #10
                    Hi Muriel,

                    THanks for your reply!!

                    Kind regards


                    Latest Articles


                    • seqadmin
                      Current Approaches to Protein Sequencing
                      by seqadmin

                      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                      04-04-2024, 04:25 PM
                    • seqadmin
                      Strategies for Sequencing Challenging Samples
                      by seqadmin

                      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
                      03-22-2024, 06:39 AM





                    Topics Statistics Last Post
                    Started by seqadmin, 04-11-2024, 12:08 PM
                    0 responses
                    Last Post seqadmin  
                    Started by seqadmin, 04-10-2024, 10:19 PM
                    0 responses
                    Last Post seqadmin  
                    Started by seqadmin, 04-10-2024, 09:21 AM
                    0 responses
                    Last Post seqadmin  
                    Started by seqadmin, 04-04-2024, 09:00 AM
                    0 responses
                    Last Post seqadmin  