Announcement

Collapse

Welcome to the New Seqanswers!

Welcome to the new Seqanswers! We'd love your feedback, please post any you have to this topic: New Seqanswers Feedback.
See more
See less

cuffdiff segfault

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • cuffdiff segfault

    cufflinks works, cuffcompare works. problem is with cuffdiff. entire pipeline is tophat/cufflinks. i've tried my reference gtf, the combined gtf, regenerating the sam files, my own local executable, our system level executable (both v0.8.1).

    version: cufflinks-0.8.1

    gdb says the segfault occurs on line 174 of gff.cpp:
    Code:
    173.  GffLine::GffLine(GffReader* reader, const char* l) {
    174.  line=Gstrdup(l);
    cmd:
    Code:
    ~/cufflinks-0.8.1/src/cuffdiff combined.gtf inputs/vee.sam inputs/cee.sam
    sample from combined.gtf:
    Code:
    chromosome_10   Cufflinks       exon    21426   21528   .       +       .       gene_id "XLOC_000001"; transcript_id "TCONS_00000001"; exon_number "1"; oId "CUFF.30735.0"; class_code "u";
    chromosome_10   Cufflinks       exon    21441   21826   .       +       .       gene_id "XLOC_000001"; transcript_id "TCONS_00007198"; exon_number "1"; oId "CUFF.28869.0"; class_code "u";
    chromosome_10   Cufflinks       exon    21581   21866   .       +       .       gene_id "XLOC_000001"; transcript_id "TCONS_00000002"; exon_number "1"; oId "CUFF.30738.0"; class_code "u"; tss_id "TSS1";
    chromosome_10   Cufflinks       exon    22318   22417   .       +       .       gene_id "XLOC_000001"; transcript_id "TCONS_00000002"; exon_number "2"; oId "CUFF.30738.0"; class_code "u"; tss_id "TSS1";
    chromosome_10   Cufflinks       exon    22572   22791   .       +       .       gene_id "XLOC_000001"; transcript_id "TCONS_00000002"; exon_number "3"; oId "CUFF.30738.0"; class_code "u"; tss_id "TSS1";
    chromosome_10   Cufflinks       exon    22349   22395   .       +       .       gene_id "XLOC_000001"; transcript_id "TCONS_00007199"; exon_number "1"; oId "CUFF.28872.0"; class_code "u";
    chromosome_10   Cufflinks       exon    22755   22853   .       +       .       gene_id "XLOC_000001"; transcript_id "TCONS_00007200"; exon_number "1"; oId "CUFF.28875.0"; class_code "u";
    chromosome_10   Cufflinks       exon    30444   30520   .       +       .       gene_id "XLOC_000002"; transcript_id "TCONS_00000003"; exon_number "1"; oId "CUFF.30777.0"; nearest_ref "c10_t4.0"; class_code "c";
    chromosome_10   Cufflinks       exon    30576   30642   .       +       .       gene_id "XLOC_000002"; transcript_id "TCONS_00000004"; exon_number "1"; oId "CUFF.30780.0"; class_code ".";
    sample from vee.sam:
    Code:
    HWI-EAS440_0001_1_101_1060_262  16      chromosome_1    202     1       36M     *       0       0       AGAGTCGAACTGGCCACTAAGCCACACGCATACACA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_1_9_922_1813    0       chromosome_1    249     1       36M     *       0       0       CGGCCGCCTAAGTAAGGGCACATGCATGCTGTTGCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:1
    HWI-EAS440_0001_1_104_318_312   0       chromosome_1    485     1       36M     *       0       0       TGGGCAGTGACAAATCTTAGCAACACGGGATGAATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:1
    HWI-EAS440_0001_1_102_1682_1855 0       chromosome_1    493     1       36M     *       0       0       GACAAATCTTAGCAACACGGGATGAATCTCAGTGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_1_116_1293_882  0       chromosome_1    493     1       36M     *       0       0       TACAAATCTTAGCAACACGGGATGAATCTCAGTGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:1
    HWI-EAS440_0001_1_39_238_1487   0       chromosome_1    493     1       36M     *       0       0       CACAAATCTTAGCAACACGGGATGAATCTCAGTGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:1
    HWI-EAS440_0001_1_93_1308_1823  0       chromosome_1    496     1       36M     *       0       0       AAATCTTAGCAACACGGGATGAATCTCAGTGGATCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_1_6_1247_1568   0       chromosome_1    501     1       36M     *       0       0       TTAGCAACACGGGATGAATCTCAGTGGATCGTAGCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_1_5_1558_914    0       chromosome_1    502     1       36M     *       0       0       TAGCAACACGGGATGAATCTCAGTGGATCGTAGCAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_1_7_1756_389    0       chromosome_1    505     1       36M     *       0       0       CAACACGGGATGAATCTCAGTGGATCGTAGCAGCAA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    sample from cee.sam:
    Code:
    HWI-EAS440_0001_2_27_801_1517   16      chromosome_1    17      1       36M     *       0       0       CCCAATCCTGAAAAGCGATTTCCACATACATAAACG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_98_465_797    16      chromosome_1    203     1       36M     *       0       0       GAGTCGAACTGGCCACTAAGCCACACGCATACACAC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_98_338_972    0       chromosome_1    493     1       36M     *       0       0       GACAAATCTTAGCAACACGGGATGAATCTCAGTGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_2_857_1311    0       chromosome_1    495     1       36M     *       0       0       CAAATCTTAGCAACACGGGATGAATCTCAGTGGATC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_119_633_903   0       chromosome_1    496     1       36M     *       0       0       AAATCTTAGCAACACGGGATGAATCTCAGTGGATCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_30_1193_818   0       chromosome_1    496     1       36M     *       0       0       AAATCTTAGCAACACGGGATGAATCTCAGTGGATCG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_91_1490_372   0       chromosome_1    497     1       36M     *       0       0       AATCTTAGCAACACGGGATGAATCTCAGTGGATCGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_10_1482_383   16      chromosome_1    499     1       36M     *       0       0       TCGTAGCAACACGGGATGAATCTCAGTGGATCGTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:1
    HWI-EAS440_0001_2_111_1039_52   0       chromosome_1    499     1       36M     *       0       0       TCTTAGCAACACGGGATGAATCTCAGTGGATCGTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    HWI-EAS440_0001_2_17_484_1454   0       chromosome_1    499     1       36M     *       0       0       TCTTAGCAACACGGGATGAATCTCAGTGGATCGTAG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII    NM:i:0
    Last edited by Ichinichi; 03-05-2010, 10:01 AM.
Working...
X